Result : P0AD73
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | phe operon leader peptide (phe operon attenuator peptide) |
| NCBI Accession ID | AE005674.2 |
| Organism | Shigella flexneri |
| Left | 2736250 |
| Right | 2736297 |
| Strand | + |
| Nucleotide Sequence | ATGAAACACATACCGTTTTTCTTCGCATTCTTTTTTACCTTCCCCTGA |
| Sequence | MKHIPFFFAFFFTFP |
| Source of smORF | Swiss-Prot |
| Function | This protein is involved in control of the biosynthesis of phenylalanine. {ECO:0000250}. |
| Pubmed ID | 12384590 12704152 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0AD73 |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2737599 | 2737646 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2736250 | 2736297 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 913329 | 913376 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07724.16 | 1.0 | 3 | 3426 | opposite-strand | AAA domain (Cdc48 subfamily) |
| 2 | PF17871.3 | 1.0 | 3 | 3426 | opposite-strand | AAA lid domain |
| 3 | PF02861.22 | 1.0 | 3 | 3426 | opposite-strand | Clp amino terminal domain, pathogenicity island component |
| 4 | PF10431.11 | 1.0 | 3 | 3426 | opposite-strand | C-terminal, D2-small domain, of ClpB protein |
| 5 | PF00004.31 | 1.0 | 3 | 3426 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 6 | PF07728.16 | 1.0 | 3 | 3426 | opposite-strand | AAA domain (dynein-related subfamily) |
| 7 | PF02578.17 | 1.0 | 3 | 2642 | opposite-strand | Multi-copper polyphenol oxidoreductase laccase |
| 8 | PF00849.24 | 1.0 | 3 | 1665 | opposite-strand | RNA pseudouridylate synthase |
| 9 | PF01479.27 | 1.0 | 3 | 1665 | opposite-strand | S4 domain |
| 10 | PF13525.8 | 0.67 | 2 | 757.5 | same-strand | Outer membrane lipoprotein |
| 11 | PF13512.8 | 0.67 | 2 | 757.5 | same-strand | Tetratricopeptide repeat |
| 12 | PF02482.21 | 1.0 | 3 | 104 | same-strand | Sigma 54 modulation protein / S30EA ribosomal protein |
| 13 | PF00800.20 | 1.0 | 3 | 99 | same-strand | Prephenate dehydratase |
| 14 | PF01817.23 | 1.0 | 3 | 700.5 | both-strands | Chorismate mutase type II |
| 15 | PF02153.19 | 1.0 | 3 | 1302 | opposite-strand | Prephenate dehydrogenase |
| 16 | PF00793.22 | 1.0 | 3 | 2434 | opposite-strand | DAHP synthetase I family |
| 17 | PF10973.10 | 0.67 | 2 | 3717.0 | same-strand | Protein of unknown function (DUF2799) |
| 18 | PF13689.8 | 0.67 | 2 | 4229.0 | same-strand | YfiR/HmsC-like |
++ More..