Result : P0ABM7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Heme exporter protein D (Cytochrome c-type biogenesis protein CcmD) |
| NCBI Accession ID | AE005174.2 |
| Organism | Escherichia coli O157:H7 |
| Left | 3100199 |
| Right | 3100408 |
| Strand | - |
| Nucleotide Sequence | ATGACCCCTGCATTTGCTTCCTGGAATGAATTTTTCGCAATGGGCGGTTACGCCTTTTTTGTCTGGCTGGCGGTGGTGATGACCGTTATTCCGCTGGTGGTTTTGGTCGTGCACTCGGTGATGCAGCATCGCGCAATTCTGCGTGGTGTGGCGCAACAGCGGGCGCGTGAGGCGCGTTTACGTGCTGCGCAACAGCAGGAGGCTGCATGA |
| Sequence | MTPAFASWNEFFAMGGYAFFVWLAVVMTVIPLVVLVVHSVMQHRAILRGVAQQRAREARLRAAQQQEAA |
| Source of smORF | Swiss-Prot |
| Function | Required for the export of heme to the periplasm for the biogenesis of c-type cytochromes. {ECO:0000250}. |
| Pubmed ID | 11206551 11258796 |
| Domain | CDD:416290 |
| Functional Category | Others |
| Uniprot ID | P0ABM7 |
| ORF Length (Amino Acid) | 69 |
++ More..
| Conservation Analysis |
No. of Species: 62
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2785810 | 2786019 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 2 | 2837859 | 2838068 | - | NZ_LR134340.1 | Escherichia marmotae |
| 3 | 2317377 | 2317586 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2295377 | 2295586 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 3029065 | 3029274 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 6 | 1290609 | 1290818 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 2303184 | 2303393 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 1014108 | 1014320 | - | NZ_CP033744.1 | Citrobacter freundii |
| 9 | 236469 | 236681 | + | NZ_CP038469.1 | Citrobacter tructae |
| 10 | 4054905 | 4055117 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 11 | 1304176 | 1304388 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 12 | 1288768 | 1288980 | + | NZ_CP023525.1 | Cedecea neteri |
| 13 | 2739293 | 2739523 | - | NZ_LN907827.1 | Erwinia gerundensis |
| 14 | 1250652 | 1250825 | + | NZ_LR134201.1 | Cedecea lapagei |
| 15 | 2606220 | 2606453 | - | NZ_CP023567.1 | Erwinia pyrifoliae |
| 16 | 1421013 | 1421246 | + | NC_017554.1 | Pantoea ananatis PA13 |
| 17 | 3527420 | 3527653 | - | NC_014306.1 | Erwinia billingiae Eb661 |
| 18 | 3102852 | 3103091 | - | NZ_CP050150.1 | Hafnia alvei |
| 19 | 2615586 | 2615801 | - | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
| 20 | 1467935 | 1468168 | - | NZ_CP049115.1 | Pantoea stewartii |
| 21 | 1724137 | 1724358 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 22 | 2450632 | 2450847 | - | NZ_CP029185.2 | Limnobaculum parvum |
| 23 | 1164984 | 1165199 | + | NZ_LS483470.1 | Leminorella richardii |
| 24 | 4391277 | 4391498 | - | NZ_CP047495.1 | Pectobacterium brasiliense |
| 25 | 1988303 | 1988524 | + | NZ_CP051652.1 | Pectobacterium carotovorum |
| 26 | 3762859 | 3763071 | - | NZ_CP029736.1 | Providencia rettgeri |
| 27 | 2523994 | 2524206 | - | NZ_CP031123.2 | Providencia huaxiensis |
| 28 | 2112509 | 2112730 | + | NZ_CP034938.1 | Pectobacterium odoriferum |
| 29 | 3187332 | 3187559 | - | NZ_CP026377.1 | Mixta gaviniae |
| 30 | 1227171 | 1227386 | + | NZ_LR134531.1 | Pragia fontium |
| 31 | 2314209 | 2314436 | - | NZ_CP028271.1 | Mixta intestinalis |
| 32 | 3024631 | 3024858 | - | NZ_CP061511.1 | Mixta calida |
| 33 | 2968391 | 2968612 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 34 | 1267450 | 1267683 | + | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 35 | 2830404 | 2830631 | + | NZ_CP019706.1 | Pantoea alhagi |
| 36 | 2991386 | 2991604 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 37 | 2516077 | 2516310 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 38 | 1098994 | 1099206 | - | NZ_CP011078.1 | Yersinia ruckeri |
| 39 | 1144321 | 1144545 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 40 | 2664836 | 2665069 | - | NC_012779.2 | Edwardsiella ictaluri 93-146 |
| 41 | 1130154 | 1130375 | + | NZ_CP015749.1 | Pectobacterium parmentieri |
| 42 | 2734848 | 2735081 | + | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 43 | 4705369 | 4705590 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 44 | 4348303 | 4348539 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 45 | 2771446 | 2771667 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 46 | 2900169 | 2900390 | - | NZ_CP065044.1 | Pectobacterium aroidearum |
| 47 | 4849563 | 4849781 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 48 | 4221116 | 4221334 | - | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
| 49 | 1512741 | 1512914 | + | NZ_CP050851.1 | Aeromonas hydrophila |
| 50 | 1244332 | 1244565 | + | NZ_CP045720.1 | Pantoea eucalypti |
| 51 | 467595 | 467828 | - | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 52 | 3721333 | 3721569 | - | NZ_LT906479.1 | Serratia ficaria |
| 53 | 3687017 | 3687253 | - | NZ_CP038662.1 | Serratia nematodiphila |
| 54 | 3002685 | 3002921 | - | NZ_CP016948.1 | Serratia surfactantfaciens |
| 55 | 5269356 | 5269553 | + | NC_009831.1 | Shewanella sediminis HAW-EB3 |
| 56 | 1412021 | 1412257 | + | NZ_CP071320.1 | Serratia ureilytica |
| 57 | 3816780 | 3817016 | - | NC_015567.1 | Serratia plymuthica AS9 |
| 58 | 3765257 | 3765493 | - | NZ_LR134494.1 | Serratia quinivorans |
| 59 | 3695105 | 3695341 | - | NZ_CP048784.1 | Serratia liquefaciens |
| 60 | 1130673 | 1130867 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 61 | 3026291 | 3026485 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 62 | 399442 | 399624 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 63 | 2106297 | 2106494 | - | NC_011566.1 | Shewanella piezotolerans WP3 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP061527.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03918.16 | 0.97 | 60 | 2983 | same-strand | Cytochrome C biogenesis protein |
| 2 | PF08534.12 | 0.97 | 60 | 2428 | same-strand | Redoxin |
| 3 | PF00578.23 | 0.97 | 60 | 2428 | same-strand | AhpC/TSA family |
| 4 | PF13098.8 | 0.97 | 60 | 2428 | same-strand | Thioredoxin-like domain |
| 5 | PF16327.7 | 0.97 | 60 | 476 | same-strand | Cytochrome c-type biogenesis protein CcmF C-terminal |
| 6 | PF01578.22 | 1.0 | 62 | 36 | same-strand | Cytochrome C assembly protein |
| 7 | PF03100.17 | 0.98 | 61 | -3.0 | same-strand | CcmE |
| 8 | PF03379.15 | 0.97 | 60 | 805 | same-strand | CcmB protein |
| 9 | PF00005.29 | 0.97 | 60 | 1454 | same-strand | ABC transporter |
++ More..