Result : P0A3N3
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Tetracycline resistance leader peptide |
| NCBI Accession ID | X60828.1 |
| Organism | Staphylococcus hyicus |
| Left | 72 |
| Right | 134 |
| Strand | + |
| Nucleotide Sequence | ATGAAGTGTAATGAATGTAACAGGGTTCAATTAAAAGAGGGAAGCGTATCATTAACCCTATAA |
| Sequence | MKCNECNRVQLKEGSVSLTL |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam08050. Profile Description: Tetracycline resistance leader peptide. This family consists of the tetracycline resistance leader peptide. The presence of 3 inverted repeats which can form 2 different conformations of mRNA suggests that the tetracycline resistance (TcR) region is regulated by a translational attenuation mechanism. A Rho-independent transcriptional terminator structure is present immediately after the translational stop codon of the TET protein. |
| Pubmed ID | 1622166 |
| Domain | CDD:254601 |
| Functional Category | Others |
| Uniprot ID | P0A3N3 |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1015966 | 1016028 | + | NZ_CP017962.1 | Virgibacillus halodenitrificans |
| 2 | 2305031 | 2305093 | - | NZ_CP017962.1 | Virgibacillus halodenitrificans |
| 3 | 4189091 | 4189153 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 4 | 1381937 | 1381999 | + | NZ_CP011937.1 | Bacillus velezensis |
| 5 | 2606073 | 2606135 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 6 | 3975880 | 3975942 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 7 | 748153 | 748215 | - | NZ_CP041305.1 | Cytobacillus ciccensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000964.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07690.18 | 1.0 | 6 | 34 | same-strand | Major Facilitator Superfamily |
| 2 | PF00583.27 | 0.67 | 4 | 2073 | same-strand | Acetyltransferase (GNAT) family |
| 3 | PF13508.9 | 0.67 | 4 | 2073 | same-strand | Acetyltransferase (GNAT) domain |
++ More..