Result : P08497
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Aspartokinase II operon leader peptide (lysC operon attenuator peptide) |
| NCBI Accession ID | J03294.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 2352 |
| Right | 2426 |
| Strand | + |
| Nucleotide Sequence | GTGAAAAAGGCTGAAAGGGGAGCGTCGCCGAAGCAAATAAAACCCCATCGGTATTATTTGCTGGCCGTGCATTGA |
| Sequence | MKKAERGASPKQIKPHRYYLLAVH |
| Source of smORF | Swiss-Prot |
| Function | Involved in the repression of the lysC operon which encodes aspartokinase 2. {ECO:0000269|Pubmed:1624109}. |
| Pubmed ID | 3036830 8969504 9384377 1624109 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P08497 |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 11
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2787814 | 2787888 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 2 | 2721344 | 2721418 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 3 | 2794386 | 2794460 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 4 | 2910922 | 2910996 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 5 | 3385767 | 3385850 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 6 | 2715930 | 2716013 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 7 | 2727896 | 2727970 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 8 | 3253170 | 3253244 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 9 | 2878247 | 2878321 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 10 | 2749686 | 2749769 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 11 | 1238090 | 1238173 | + | NZ_CP011937.1 | Bacillus velezensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP013984.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13085.8 | 0.91 | 10 | 4595.0 | same-strand | 2Fe-2S iron-sulfur cluster binding domain |
| 2 | PF13183.8 | 0.91 | 10 | 4595.0 | same-strand | 4Fe-4S dicluster domain |
| 3 | PF13237.8 | 0.91 | 10 | 4595.0 | same-strand | 4Fe-4S dicluster domain |
| 4 | PF13534.8 | 0.91 | 10 | 4595.0 | same-strand | 4Fe-4S dicluster domain |
| 5 | PF00890.26 | 1.0 | 11 | 2832 | same-strand | FAD binding domain |
| 6 | PF02910.22 | 1.0 | 11 | 2832 | same-strand | Fumarate reductase flavoprotein C-term |
| 7 | PF01127.24 | 1.0 | 11 | 2190 | same-strand | Succinate dehydrogenase/Fumarate reductase transmembrane subunit |
| 8 | PF10702.11 | 1.0 | 11 | 1452 | opposite-strand | Protein of unknown function (DUF2507) |
| 9 | PF00696.30 | 1.0 | 11 | 176 | same-strand | Amino acid kinase family |
| 10 | PF13840.8 | 1.0 | 11 | 176 | same-strand | ACT domain |
| 11 | PF08459.13 | 1.0 | 11 | 120 | same-strand | UvrC RIbonuclease H-like domain |
| 12 | PF02151.21 | 1.0 | 11 | 120 | same-strand | UvrB/uvrC motif |
| 13 | PF01541.26 | 1.0 | 11 | 120 | same-strand | GIY-YIG catalytic domain |
| 14 | PF14520.8 | 0.91 | 10 | 120.0 | same-strand | Helix-hairpin-helix domain |
| 15 | PF00085.22 | 1.0 | 11 | 2028 | same-strand | Thioredoxin |
| 16 | PF13098.8 | 1.0 | 11 | 2028 | same-strand | Thioredoxin-like domain |
| 17 | PF13192.8 | 1.0 | 11 | 2028 | same-strand | Thioredoxin domain |
| 18 | PF00462.26 | 1.0 | 11 | 2028 | same-strand | Glutaredoxin |
| 19 | PF06964.14 | 0.82 | 9 | 2665 | same-strand | Alpha-L-arabinofuranosidase C-terminal domain |
| 20 | PF01012.23 | 1.0 | 11 | 4368.5 | same-strand | Electron transfer flavoprotein domain |
| 21 | PF00766.21 | 1.0 | 11 | 4340 | same-strand | Electron transfer flavoprotein FAD-binding domain |
++ More..