Result : P07790

Protein Information

• Protein name: Spore coat protein C
• NCBI Accession ID: X05680.1
• Organism: Bacillus subtilis (strain 168)
• Left: 356
• Right: 556
• Strand: +
• Nucleotide Sequence: ATGGGTTATTACAAAAAATACAAAGAAGAGTATTATACGGTCAAAAAAACGTATTATAAGAAGTATTACGAATATGATAAAAAAGATTATGACTGTGATTACGACAAAAAATATGATGACTATGATAAAAAATATTATGATCACGATAAAAAAGACTATGATTATGTTGTAGAGTATAAAAAGCATAAAAAACACTACTAA
• Sequence: MGYYKKYKEEYYTVKKTYYKKYYEYDKKDYDCDYDKKYDDYDKKYYDHDKKDYDYVVEYKKHKKHY
• Source of smORF: Swiss-Prot
• Pubmed ID: 2821284 9384377 1691789
• Functional Category: Others
• Uniprot ID: P07790
• ORF Length (Amino Acid): 66

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1904995	1905195	-	NC_000964.3	Bacillus subtilis subsp. subtilis str. 168
2	1873170	1873394	-	NZ_CP048852.1	Bacillus tequilensis
3	1835298	1835501	-	NZ_CP051464.1	Bacillus mojavensis

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000964.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00303.21	0.67	2	2167.0	opposite-strand	Thymidylate synthase
2	PF15493.8	1.0	3	732	same-strand	Domain of unknown function, YrpD
3	PF14037.8	0.67	2	239.5	same-strand	YoqO-like protein
4	PF02416.18	1.0	3	180	same-strand	mttA/Hcf106 family
5	PF08327.13	0.67	2	954.5	same-strand	Activator of Hsp90 ATPase homolog 1-like protein