Result : P05624
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | trp operon leader peptide |
| NCBI Accession ID | X07744.1 |
| Organism | Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579) |
| Left | 72 |
| Right | 107 |
| Strand | + |
| Nucleotide Sequence | ATGGCCCTTCCCTCCGCCCTCTGGTGGCCCGGCTAG |
| Sequence | MALPSALWWPG |
| Source of smORF | Swiss-Prot |
| Function | This protein is involved in control of the biosynthesis of tryptophan. |
| Pubmed ID | 2844259 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P05624 |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 258427 | 258462 | + | NZ_CP014141.1 | Thermus parvatiensis |
| 2 | 1729573 | 1729608 | - | NC_006461.1 | Thermus thermophilus HB8 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP014141.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13279.8 | 1.0 | 2 | 40.0 | same-strand | Thioesterase-like superfamily |
| 2 | PF03061.24 | 1.0 | 2 | 40.0 | same-strand | Thioesterase superfamily |
| 3 | PF04715.15 | 1.0 | 2 | 62.0 | same-strand | Anthranilate synthase component I, N terminal region |
| 4 | PF00425.20 | 1.0 | 2 | 367.5 | same-strand | chorismate binding enzyme |
| 5 | PF00117.30 | 1.0 | 2 | 1487.5 | same-strand | Glutamine amidotransferase class-I |
| 6 | PF00591.23 | 1.0 | 2 | 2056.5 | same-strand | Glycosyl transferase family, a/b domain |
| 7 | PF02885.19 | 1.0 | 2 | 2056.5 | same-strand | Glycosyl transferase family, helical bundle domain |
| 8 | PF00355.28 | 1.0 | 2 | 3042.5 | opposite-strand | Rieske [2Fe-2S] domain |
| 9 | PF13806.8 | 1.0 | 2 | 3042.5 | opposite-strand | Rieske-like [2Fe-2S] domain |
++ More..