Result : P03063
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 23S rRNA methylase leader peptide (Erythromycin resistance leader peptide) |
| NCBI Accession ID | V01278.1 |
| Organism | Staphylococcus aureus |
| Left | 2798 |
| Right | 2857 |
| Strand | - |
| Nucleotide Sequence | ATGGGCATTTTTAGTATTTTTGTAATCAGCACAGTTCATTATCAACCAAACAAAAAATAA |
| Sequence | MGIFSIFVISTVHYQPNKK |
| Source of smORF | Swiss-Prot |
| Function | This peptide is involved in the control mechanism of the synthesis of the erythromycin resistance protein. |
| Pubmed ID | 6162157 6938954 2414456 2467989 3141573 |
| Domain | CDD:411286 |
| Functional Category | Others |
| Uniprot ID | P03063 |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 267114 | 267173 | + | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 2 | 1278596 | 1278655 | - | NZ_AP018587.1 | Staphylococcus caprae |
| 3 | 1196674 | 1196733 | + | NZ_CP023434.1 | Suicoccus acidiformans |
| 4 | 583943 | 584002 | + | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 5 | 1640247 | 1640306 | - | NZ_CP022096.2 | Staphylococcus pettenkoferi |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP018587.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00398.22 | 0.75 | 3 | 58.0 | same-strand | Ribosomal RNA adenine dimethylase |
| 2 | PF00589.24 | 0.75 | 3 | 3176.5 | opposite-strand | Phage integrase family |
| 3 | PF02899.19 | 0.75 | 3 | 4121.0 | opposite-strand | Phage integrase, N-terminal SAM-like domain |
| 4 | PF19776.1 | 0.75 | 3 | 1848.0 | opposite-strand | Family of unknown function (DUF6262) |
| 5 | PF13427.8 | 0.75 | 3 | 915.0 | opposite-strand | Domain of unknown function (DUF4111) |
| 6 | PF01909.25 | 0.75 | 3 | 915.0 | opposite-strand | Nucleotidyltransferase domain |
| 7 | PF08241.14 | 0.75 | 3 | 392.0 | opposite-strand | Methyltransferase domain |
| 8 | PF13649.8 | 0.75 | 3 | 392.0 | opposite-strand | Methyltransferase domain |
| 9 | PF08242.14 | 0.75 | 3 | 392.0 | opposite-strand | Methyltransferase domain |
++ More..