Result : P03062
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | leu operon leader peptide (leu operon attenuator peptide) |
| NCBI Accession ID | AE006468.2 |
| Organism | Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) |
| Left | 133826 |
| Right | 133912 |
| Strand | - |
| Nucleotide Sequence | ATGTCACATATCGTTCGTTTCACTGGGCTACTACTACTCAACGCATTTATTGTGCGCGGTAGACCGGTGGGCGGCATTCAACATTAA |
| Sequence | MSHIVRFTGLLLLNAFIVRGRPVGGIQH |
| Source of smORF | Swiss-Prot |
| Function | Involved in control of the biosynthesis of leucine. |
| Pubmed ID | 388423 11677609 |
| Domain | CDD:137592 |
| Functional Category | Others |
| Uniprot ID | P03062 |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 52
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 133826 | 133912 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2719942 | 2720028 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 705911 | 705997 | - | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 84946 | 85032 | - | NZ_AP014857.1 | Escherichia albertii |
| 5 | 88230 | 88316 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 6 | 83622 | 83708 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 7 | 81464 | 81550 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 8 | 99284 | 99370 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 4025085 | 4025171 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 10 | 3529857 | 3529943 | - | NZ_CP033744.1 | Citrobacter freundii |
| 11 | 3278470 | 3278556 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 12 | 3510384 | 3510467 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 13 | 2308590 | 2308676 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 14 | 3893889 | 3893975 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 15 | 4816486 | 4816572 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 16 | 3070823 | 3070909 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 17 | 875196 | 875282 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 18 | 3887712 | 3887798 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 19 | 1784541 | 1784627 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 20 | 727247 | 727333 | - | NC_015968.1 | Enterobacter soli |
| 21 | 746620 | 746706 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 22 | 723776 | 723862 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 23 | 748032 | 748118 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 24 | 769059 | 769145 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 25 | 3639106 | 3639189 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 26 | 5043117 | 5043203 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 27 | 4317250 | 4317336 | + | NZ_LR134475.1 | Klebsiella aerogenes |
| 28 | 3854243 | 3854329 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 29 | 1871580 | 1871666 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 30 | 576380 | 576466 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 31 | 4511320 | 4511406 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 32 | 801380 | 801460 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 33 | 4646453 | 4646539 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 34 | 2585769 | 2585855 | - | NZ_CP026047.1 | Raoultella planticola |
| 35 | 4428652 | 4428738 | + | NZ_CP041247.1 | Raoultella electrica |
| 36 | 776000 | 776086 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 37 | 3402791 | 3402877 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 38 | 2655053 | 2655139 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 39 | 3768906 | 3768992 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 40 | 2296680 | 2296766 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 41 | 2595000 | 2595080 | + | NZ_CP038469.1 | Citrobacter tructae |
| 42 | 2998277 | 2998360 | + | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 43 | 2792194 | 2792280 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 44 | 3145953 | 3146036 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 45 | 704227 | 704310 | - | NZ_CP048784.1 | Serratia liquefaciens |
| 46 | 5107542 | 5107628 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 47 | 3771849 | 3771932 | + | NC_017554.1 | Pantoea ananatis PA13 |
| 48 | 3868152 | 3868238 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 49 | 4370984 | 4371070 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 50 | 4645203 | 4645289 | + | NZ_CP054254.1 | Klebsiella variicola |
| 51 | 844239 | 844325 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 52 | 4995354 | 4995440 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 53 | 2275145 | 2275228 | - | NZ_CP065640.1 | Serratia rubidaea |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00694.21 | 1.0 | 52 | 4168 | same-strand | Aconitase C-terminal domain |
| 2 | PF00330.22 | 1.0 | 52 | 2757 | same-strand | Aconitase family (aconitate hydratase) |
| 3 | PF00180.22 | 1.0 | 52 | 1664 | same-strand | Isocitrate/isopropylmalate dehydrogenase |
| 4 | PF00682.21 | 1.0 | 52 | 92 | same-strand | HMGL-like |
| 5 | PF08502.12 | 1.0 | 52 | 92 | same-strand | LeuA allosteric (dimerisation) domain |
| 6 | PF00126.29 | 0.92 | 48 | 628 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 7 | PF03466.22 | 0.92 | 48 | 628 | opposite-strand | LysR substrate binding domain |
| 8 | PF02775.23 | 1.0 | 52 | 1950 | opposite-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 9 | PF02776.20 | 1.0 | 52 | 1950 | opposite-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 10 | PF00205.24 | 1.0 | 52 | 1950 | opposite-strand | Thiamine pyrophosphate enzyme, central domain |
| 11 | PF10369.11 | 0.98 | 51 | 3661.0 | opposite-strand | Small subunit of acetolactate synthase |
| 12 | PF13710.8 | 0.98 | 51 | 3661.0 | opposite-strand | ACT domain |
| 13 | PF01842.27 | 0.98 | 51 | 3661.0 | opposite-strand | ACT domain |
| 14 | PF13291.8 | 0.98 | 51 | 3661.0 | opposite-strand | ACT domain |
| 15 | PF00356.23 | 0.98 | 51 | 4357 | opposite-strand | Bacterial regulatory proteins, lacI family |
| 16 | PF00532.23 | 0.92 | 48 | 4357.0 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 17 | PF13377.8 | 0.96 | 50 | 4357.0 | opposite-strand | Periplasmic binding protein-like domain |
| 18 | PF02381.20 | 0.83 | 43 | 5935.0 | opposite-strand | MraZ protein, putative antitoxin-like |
++ More..