| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | ilv operon leader peptide (ilvBN operon attenuator peptide) |
| NCBI Accession ID | X02541.1 |
| Organism | Escherichia coli (strain K12) |
| Left | 141 |
| Right | 239 |
| Strand | + |
| Nucleotide Sequence | ATGACTACTTCCATGCTCAACGCAAAACTACTACCAACTGCGCCATCCGCCGCAGTGGTCGTCGTGCGTGTGGTGGTGGTCGTCGGCAATGCGCCGTAG |
| Sequence | MTTSMLNAKLLPTAPSAAVVVVRVVVVVGNAP |
| Source of smORF | Swiss-Prot |
| Function | This protein is involved in control of the biosynthesis of isoleucine, leucine, and valine. |
| Pubmed ID | 6292893 2989782 7686882 9278503 16738553 |
| Domain | CDD:182310 |
| Functional Category | Others |
| Uniprot ID | P03061 |
| ORF Length (Amino Acid) | 32 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3852890 | 3852988 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2921311 | 2921409 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 3 | 22186 | 22284 | + | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 4101173 | 4101271 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4643490 | 4643588 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 6 | 3831609 | 3831707 | - | NZ_AP014857.1 | Escherichia albertii |
| 7 | 3997724 | 3997822 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 8 | 34165 | 34263 | + | NC_015968.1 | Enterobacter soli |
| 9 | 423709 | 423807 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 10 | 1814275 | 1814373 | - | NZ_CP053416.1 | Salmonella bongori |
| 11 | 4299287 | 4299385 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 12 | 3456291 | 3456389 | + | NZ_CP038469.1 | Citrobacter tructae |
| 13 | 2634682 | 2634780 | - | NZ_CP033744.1 | Citrobacter freundii |
| 14 | 2445069 | 2445167 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07690.18 | 1.0 | 13 | 1878.5 | opposite-strand | Major Facilitator Superfamily |
| 2 | PF13710.8 | 1.0 | 13 | 1798.5 | same-strand | ACT domain |
| 3 | PF01842.27 | 1.0 | 13 | 1798.5 | same-strand | ACT domain |
| 4 | PF13291.8 | 1.0 | 13 | 1798.5 | same-strand | ACT domain |
| 5 | PF02776.20 | 1.0 | 13 | 106.5 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 6 | PF02775.23 | 1.0 | 13 | 106.5 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 7 | PF00205.24 | 1.0 | 13 | 106.5 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 8 | PF13939.8 | 0.77 | 10 | 565 | opposite-strand | Toxin TisB, type I toxin-antitoxin system |