Protein Information |
Information Type | Description |
---|---|
Protein name | Protamine-like protein |
NCBI Accession ID | U00096.3 |
Organism | Escherichia coli (strain K12) |
Left | 1287087 |
Right | 1287176 |
Strand | - |
Nucleotide Sequence | ATGAGAAGCTTCGACCAAGGTTCGACTCGAGCGCCAGCGAGAGAGCGTTGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCTGA |
Sequence | MRSFDQGSTRAPARERCRRQRPEGRSAQR |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of PRK14757. Profile Description: putative protamine-like protein; Provisional |
Pubmed ID | 7034960 7034959 8905232 9278503 16738553 |
Domain | CDD:173218 |
Functional Category | Others |
Uniprot ID | P02338 |
ORF Length (Amino Acid) | 29 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1287087 | 1287176 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 423657 | 423746 | + | NZ_CP033744.1 | Citrobacter freundii |
3 | 5027465 | 5027554 | + | NZ_CP026047.1 | Raoultella planticola |
4 | 1785429 | 1785503 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
5 | 1785252 | 1785326 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
6 | 2462804 | 2462878 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
7 | 2370809 | 2370883 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
8 | 2370531 | 2370605 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
9 | 2409064 | 2409138 | - | NZ_CP060111.1 | Klebsiella michiganensis |
10 | 1014290 | 1014364 | - | NZ_CP027107.1 | Cronobacter sakazakii |
11 | 2242566 | 2242640 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF13247.8 | 0.67 | 6 | 1953 | opposite-strand | 4Fe-4S dicluster domain |
2 | PF14711.8 | 0.67 | 6 | 1953 | opposite-strand | Respiratory nitrate reductase beta C-terminal |
3 | PF13237.8 | 0.67 | 6 | 1953 | opposite-strand | 4Fe-4S dicluster domain |
4 | PF12838.9 | 0.67 | 6 | 1953 | opposite-strand | 4Fe-4S dicluster domain |
5 | PF02613.17 | 0.67 | 6 | 2283 | opposite-strand | Nitrate reductase delta subunit |
6 | PF02665.16 | 1.0 | 9 | 850 | opposite-strand | Nitrate reductase gamma subunit |
7 | PF00551.21 | 1.0 | 9 | 582 | same-strand | Formyl transferase |
8 | PF01842.27 | 1.0 | 9 | 582 | same-strand | ACT domain |
9 | PF17775.3 | 1.0 | 9 | 1477 | same-strand | UPF0225 domain |
10 | PF02810.17 | 1.0 | 9 | 1477 | same-strand | SEC-C motif |
11 | PF01734.24 | 0.67 | 6 | 1829.0 | opposite-strand | Patatin-like phospholipase |
12 | PF00072.26 | 1.0 | 9 | 2751 | opposite-strand | Response regulator receiver domain |
13 | PF00483.25 | 0.89 | 8 | 3834.0 | opposite-strand | Nucleotidyl transferase |