Result : A3PMI6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Coenzyme PQQ synthesis protein A (Pyrroloquinoline quinone biosynthesis protein A) |
| NCBI Accession ID | CP000577.1 |
| Organism | Rhodobacter sphaeroides (strain ATCC 17029 / ATH 2.4.9) |
| Left | 2583841 |
| Right | 2583921 |
| Strand | - |
| Nucleotide Sequence | ATGGCCTGGAAGACCCCGCGTTACGACGAGACCCCGGTGGGGATGGAAATCAACATGTATGCCTGCGCCAAGCGCAAGTAA |
| Sequence | MAWKTPRYDETPVGMEINMYACAKRK |
| Source of smORF | Swiss-Prot |
| Function | Required for coenzyme pyrroloquinoline quinone (PQQ) biosynthesis. PQQ is probably formed by cross-linking a specific glutamate to a specific tyrosine residue and excising these residues from the peptide. {ECO:0000255|HAMAP-Rule:MF_00656}. |
| Pubmed ID | |
| Domain | CDD:391614 |
| Functional Category | Others |
| Uniprot ID | A3PMI6 |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 60
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2563789 | 2563869 | + | NC_020453.1 | Bradyrhizobium oligotrophicum S58 |
| 2 | 2103127 | 2103207 | - | NC_020453.1 | Bradyrhizobium oligotrophicum S58 |
| 3 | 5293192 | 5293272 | + | NZ_CP044543.1 | Bradyrhizobium betae |
| 4 | 4820438 | 4820518 | - | NZ_CP044543.1 | Bradyrhizobium betae |
| 5 | 2204699 | 2204779 | + | NC_017082.1 | Bradyrhizobium cosmicum |
| 6 | 1668774 | 1668854 | - | NC_017082.1 | Bradyrhizobium cosmicum |
| 7 | 2722439 | 2722519 | + | NZ_CP042968.1 | Bradyrhizobium paxllaeri |
| 8 | 1598159 | 1598239 | - | NZ_CP042968.1 | Bradyrhizobium paxllaeri |
| 9 | 3281223 | 3281303 | + | NZ_CP022221.1 | Bradyrhizobium zhanjiangense |
| 10 | 8113158 | 8113238 | + | NZ_CP022221.1 | Bradyrhizobium zhanjiangense |
| 11 | 6490819 | 6490899 | - | NZ_CP058354.1 | Bradyrhizobium japonicum |
| 12 | 7320849 | 7320929 | + | NZ_CP058354.1 | Bradyrhizobium japonicum |
| 13 | 6759722 | 6759802 | - | NZ_CP032617.1 | Bradyrhizobium diazoefficiens |
| 14 | 7355389 | 7355469 | + | NZ_CP032617.1 | Bradyrhizobium diazoefficiens |
| 15 | 2727620 | 2727700 | + | NZ_LS398110.1 | Bradyrhizobium vignae |
| 16 | 2298364 | 2298444 | - | NZ_LS398110.1 | Bradyrhizobium vignae |
| 17 | 4770297 | 4770377 | - | NZ_CP022219.1 | Bradyrhizobium guangxiense |
| 18 | 5266499 | 5266579 | + | NZ_CP022219.1 | Bradyrhizobium guangxiense |
| 19 | 2339040 | 2339120 | + | NZ_CP030051.1 | Bradyrhizobium guangdongense |
| 20 | 1980982 | 1981062 | - | NZ_CP030051.1 | Bradyrhizobium guangdongense |
| 21 | 2175439 | 2175519 | + | NZ_CP030053.1 | Bradyrhizobium guangzhouense |
| 22 | 1750647 | 1750727 | - | NZ_CP030053.1 | Bradyrhizobium guangzhouense |
| 23 | 7227799 | 7227879 | - | NZ_CP030050.1 | Bradyrhizobium arachidis |
| 24 | 8026224 | 8026304 | + | NZ_CP030050.1 | Bradyrhizobium arachidis |
| 25 | 4867876 | 4867956 | + | NZ_CP029425.1 | Bradyrhizobium ottawaense |
| 26 | 4378164 | 4378244 | - | NZ_CP029425.1 | Bradyrhizobium ottawaense |
| 27 | 4921428 | 4921508 | - | NZ_CP029426.1 | Bradyrhizobium amphicarpaeae |
| 28 | 5454868 | 5454948 | + | NZ_CP029426.1 | Bradyrhizobium amphicarpaeae |
| 29 | 4317396 | 4317476 | + | NZ_CP050066.1 | Bradyrhizobium symbiodeficiens |
| 30 | 3830185 | 3830265 | - | NZ_CP050066.1 | Bradyrhizobium symbiodeficiens |
| 31 | 2895787 | 2895867 | + | NZ_CP016428.1 | Bradyrhizobium icense |
| 32 | 1426357 | 1426437 | - | NZ_CP016428.1 | Bradyrhizobium icense |
| 33 | 2543218 | 2543310 | - | NZ_CP012908.1 | Ketogulonicigenium vulgare |
| 34 | 1078113 | 1078193 | - | NZ_CP053086.1 | Pelagibacterium halotolerans |
| 35 | 2150596 | 2150688 | - | NZ_CP019937.1 | Ketogulonicigenium robustum |
| 36 | 2103758 | 2103838 | + | NZ_CP058907.1 | Rhodopseudomonas palustris |
| 37 | 1205217 | 1205297 | - | NZ_CP004373.1 | Gluconobacter oxydans DSM 3504 |
| 38 | 252070 | 252150 | + | NZ_CP068983.1 | Paradevosia shaoguanensis |
| 39 | 1445483 | 1445563 | - | NZ_CP041690.1 | Youhaiella tibetensis |
| 40 | 794609 | 794689 | - | NZ_CP022113.1 | Nitrospirillum amazonense CBAmc |
| 41 | 805231 | 805308 | + | NZ_CP022113.1 | Nitrospirillum amazonense CBAmc |
| 42 | 4266479 | 4266556 | + | NZ_CP030265.1 | Skermanella pratensis |
| 43 | 3198180 | 3198260 | - | NZ_AP014690.1 | Asaia bogorensis NBRC 16594 |
| 44 | 1136870 | 1136950 | - | NZ_CP043043.1 | Gluconobacter thailandicus |
| 45 | 942243 | 942323 | - | NZ_CP038141.1 | Swingsia samuiensis |
| 46 | 2452776 | 2452856 | - | NZ_CP014681.1 | Kozakia baliensis |
| 47 | 1166948 | 1167028 | - | NZ_CP068419.1 | Gluconobacter sphaericus |
| 48 | 2783537 | 2783617 | - | NZ_CP014689.1 | Gluconobacter albidus |
| 49 | 3889871 | 3889954 | + | NZ_CP034179.1 | Caenibius tardaugens NBRC 16725 |
| 50 | 1907011 | 1907091 | + | NZ_CP019875.1 | Komagataeibacter nataicola |
| 51 | 2021515 | 2021595 | + | NC_016027.1 | Komagataeibacter medellinensis NBRC 3288 |
| 52 | 8678 | 8758 | + | NZ_CP050139.1 | Komagataeibacter rhaeticus |
| 53 | 212860 | 212940 | - | NZ_CP062147.1 | Komagataeibacter hansenii |
| 54 | 2093189 | 2093269 | + | NZ_CP036404.1 | Komagataeibacter saccharivorans |
| 55 | 1028468 | 1028548 | + | NZ_CP032485.1 | Neokomagataea tanensis |
| 56 | 1185740 | 1185820 | + | NZ_CP029176.1 | Acidibrevibacterium fodinaquatile |
| 57 | 569793 | 569873 | - | NZ_CP003182.2 | Granulibacter bethesdensis CGDNIH4 |
| 58 | 2183202 | 2183276 | - | NZ_CP003182.2 | Granulibacter bethesdensis CGDNIH4 |
| 59 | 936225 | 936305 | + | NZ_LN606600.1 | Acetobacter senegalensis |
| 60 | 2461721 | 2461801 | + | NZ_CP022374.1 | Acetobacter oryzifermentans |
| 61 | 1846669 | 1846749 | + | NZ_CP015164.1 | Acetobacter ascendens |
| 62 | 1031830 | 1031910 | + | NC_021991.1 | Acetobacter pasteurianus 386B |
| 63 | 2187923 | 2188003 | + | NZ_CP042808.1 | Acetobacter oryzoeni |
| 64 | 210483 | 210563 | - | NZ_CP012405.1 | Azospirillum thiophilum |
| 65 | 553486 | 553566 | - | NZ_CP029357.1 | Azospirillum thermophilum |
| 66 | 42923 | 43003 | + | NZ_CP012402.1 | Azospirillum thiophilum |
| 67 | 573263 | 573343 | + | NZ_CP060244.1 | Entomobacter blattae |
| 68 | 306064 | 306144 | - | NZ_CP054616.1 | Azospirillum oryzae |
| 69 | 728162 | 728242 | + | NZ_CP030126.1 | Indioceanicola profundi |
| 70 | 1231994 | 1232071 | + | NC_011666.1 | Methylocella silvestris BL2 |
| 71 | 3257817 | 3257909 | + | NZ_CP038439.1 | Paracoccus liaowanqingii |
| 72 | 116645 | 116722 | + | NC_015186.1 | Acidiphilium multivorum AIU301 |
| 73 | 486576 | 486656 | - | NZ_CP029831.1 | Azospirillum ramasamyi |
| 74 | 101335 | 101415 | + | NZ_CP029831.1 | Azospirillum ramasamyi |
| 75 | 56098 | 56178 | + | NZ_CP053708.1 | Lichenicola cladoniae |
| 76 | 3922165 | 3922242 | + | NZ_CP044331.1 | Methylocystis parvus |
| 77 | 1084880 | 1084957 | + | NZ_CP043420.1 | Kushneria phosphatilytica |
| 78 | 4209632 | 4209709 | + | NZ_CP046052.1 | Methylocystis heyeri |
| 79 | 2127643 | 2127720 | + | NZ_CP023559.1 | Salinicola tamaricis |
| 80 | 2935307 | 2935384 | + | NZ_CP019948.1 | Methylocystis bryophila |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_020453.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04055.23 | 0.92 | 55 | 2066.0 | same-strand | Radical SAM superfamily |
| 2 | PF13186.8 | 0.93 | 56 | 2030.5 | same-strand | Iron-sulfur cluster-binding domain |
| 3 | PF05402.14 | 0.95 | 57 | 1743 | same-strand | Coenzyme PQQ synthesis protein D (PqqD) |
| 4 | PF03070.18 | 0.95 | 57 | 1011 | same-strand | TENA/THI-4/PQQC family |
| 5 | PF12706.9 | 0.95 | 57 | 89 | same-strand | Beta-lactamase superfamily domain |
++ More..