Result : O83263
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein translocase subunit SecE |
| NCBI Accession ID | AE000520.1 |
| Organism | Treponema pallidum (strain Nichols) |
| Left | 242310 |
| Right | 242489 |
| Strand | + |
| Nucleotide Sequence | ATGTTGAAGTTCGCAAAGTTTCGTAGGGAGTGCGTTGCCGAGTTCAGGAGGGTGGTGTGGCCTGCGCGCACTCAGGTACATACCGCGGTTAAGGTAGTGCTCGTCTCTACCGTTGTCATGGCGCTTTTCCTCGGGCTTATCGATGCTCTGTTCGTGGCGTTGCTGAGTTTCTTCTTCTGA |
| Sequence | MLKFAKFRRECVAEFRRVVWPARTQVHTAVKVVLVSTVVMALFLGLIDALFVALLSFFF |
| Source of smORF | Swiss-Prot |
| Function | Essential subunit of the Sec protein translocation channel SecYEG. Clamps together the 2 halves of SecY. May contact the channel plug during translocation. {ECO:0000255|HAMAP-Rule:MF_00422}. |
| Pubmed ID | 9665876 |
| Domain | CDD:412402 |
| Functional Category | Others |
| Uniprot ID | O83263 |
| ORF Length (Amino Acid) | 59 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 240889 | 241068 | + | NC_015714.1 | Treponema paraluiscuniculi Cuniculi A |
| 2 | 174942 | 175121 | - | NZ_CP009228.1 | Treponema putidum |
| 3 | 465735 | 465914 | + | NC_022097.1 | Treponema pedis str. T A4 |
| 4 | 328616 | 328801 | + | NZ_CP054142.1 | Treponema parvum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015714.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00471.22 | 1.0 | 4 | 149.5 | same-strand | Ribosomal protein L33 |
| 2 | PF02357.21 | 1.0 | 4 | 6.5 | same-strand | Transcription termination factor nusG |
| 3 | PF00467.31 | 1.0 | 4 | 6.5 | same-strand | KOW motif |
| 4 | PF03946.16 | 1.0 | 4 | 672.0 | same-strand | Ribosomal protein L11, N-terminal domain |
| 5 | PF00298.21 | 1.0 | 4 | 672.0 | same-strand | Ribosomal protein L11, RNA binding domain |
| 6 | PF00687.23 | 1.0 | 4 | 1107.0 | same-strand | Ribosomal protein L1p/L10e family |
| 7 | PF00466.22 | 1.0 | 4 | 1789.5 | same-strand | Ribosomal protein L10 |
| 8 | PF00542.21 | 1.0 | 4 | 2456.0 | same-strand | Ribosomal protein L7/L12 C-terminal domain |
| 9 | PF16320.7 | 1.0 | 4 | 2456.0 | same-strand | Ribosomal protein L7/L12 dimerisation domain |
++ More..