Result : O83100
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 30S ribosomal protein S18 |
| NCBI Accession ID | AE000520.1 |
| Organism | Treponema pallidum (strain Nichols) |
| Left | 69749 |
| Right | 70048 |
| Strand | - |
| Nucleotide Sequence | ATGGCAGAAGATCATCCGAGTGTTGACCTGGATACGCATCTCAGTTCTCCTCGTGAAAGTGAAGAGAGCGCACCCAAGAAAAACAGACAATTCTATCGAAAGAAAGTATGCCGTTTTTGCACGCAGAAGCTTTTAGCTGATTATAAGGATCCGGACACGCTTCGTCGCTTTATCACAGAGCGGGGTAAGATTCTGCCGAGACGCATCACCGGTACGTGTGCCAAACACCAGCGCCGTGTTGCTCTCGAAGTCAAGCGTTCCCGCGCCGTTGCGCTCCTACCTTTCGTTCTGACCGAGTAG |
| Sequence | MAEDHPSVDLDTHLSSPRESEESAPKKNRQFYRKKVCRFCTQKLLADYKDPDTLRRFITERGKILPRRITGTCAKHQRRVALEVKRSRAVALLPFVLTE |
| Source of smORF | Swiss-Prot |
| Function | Binds as a heterodimer with protein S6 to the central domain of the 16S rRNA, where it helps stabilize the platform of the 30S subunit. {ECO:0000255|HAMAP-Rule:MF_00270}. |
| Pubmed ID | 9665876 |
| Domain | CDD:412341 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | O83100 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 39
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 69847 | 70146 | - | NC_015714.1 | Treponema paraluiscuniculi Cuniculi A |
| 2 | 1499012 | 1499314 | - | NC_022097.1 | Treponema pedis str. T A4 |
| 3 | 2240202 | 2240459 | + | NZ_CP009228.1 | Treponema putidum |
| 4 | 1729463 | 1729720 | - | NC_002967.9 | Treponema denticola ATCC 35405 |
| 5 | 3074961 | 3075272 | - | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
| 6 | 1615919 | 1616236 | - | NC_015732.1 | Treponema caldarium DSM 7334 |
| 7 | 1363780 | 1364046 | - | NZ_CP054142.1 | Treponema parvum |
| 8 | 1141767 | 1142078 | + | NZ_CP031518.1 | Treponema ruminis |
| 9 | 111344 | 111637 | - | NZ_CP007022.1 | Borrelia parkeri HR1 |
| 10 | 111420 | 111713 | - | NC_008710.1 | Borrelia turicatae 91E135 |
| 11 | 123566 | 123856 | - | NC_011244.1 | Borrelia recurrentis A1 |
| 12 | 110303 | 110593 | - | NZ_CP013704.1 | Borrelia anserina Es |
| 13 | 111454 | 111744 | - | NZ_CP011060.1 | Borrelia hermsii CC1 |
| 14 | 2860392 | 2860673 | + | NZ_CP061799.1 | Desulfonema limicola |
| 15 | 1487840 | 1488082 | + | NC_018025.1 | Desulfomonile tiedjei DSM 6799 |
| 16 | 2881245 | 2881502 | - | NC_015388.1 | Desulfobacca acetoxidans DSM 11109 |
| 17 | 820635 | 820922 | - | NC_015436.1 | Sphaerochaeta coccoides DSM 17374 |
| 18 | 794784 | 795074 | + | NZ_CP024333.1 | Borrelia miyamotoi |
| 19 | 1950205 | 1950471 | + | NC_007759.1 | Syntrophus aciditrophicus SB |
| 20 | 2790842 | 2791174 | + | NC_010814.1 | Geobacter lovleyi SZ |
| 21 | 2951484 | 2951729 | + | NC_006138.1 | Desulfotalea psychrophila LSv54 |
| 22 | 1319569 | 1319883 | + | NC_015385.1 | Treponema succinifaciens DSM 2489 |
| 23 | 3539866 | 3540126 | + | NC_016629.1 | Desulfocurvibacter africanus subsp. africanus str. Walvis Bay |
| 24 | 5092389 | 5092649 | - | NC_022571.1 | Clostridium saccharobutylicum DSM 13864 |
| 25 | 3764752 | 3765009 | + | NZ_CP030775.1 | Clostridium butyricum |
| 26 | 3000257 | 3000547 | - | NC_013205.1 | Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 |
| 27 | 3790018 | 3790284 | - | NZ_CP040924.1 | Clostridium thermarum |
| 28 | 1234332 | 1234586 | - | NC_016048.1 | Oscillibacter valericigenes Sjm18-20 |
| 29 | 3292272 | 3292535 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 30 | 878212 | 878535 | - | NZ_CP042829.1 | Tepidiforma bonchosmolovskayae |
| 31 | 66770 | 67057 | + | NC_018870.1 | Thermacetogenium phaeum DSM 12270 |
| 32 | 5199441 | 5199683 | - | NZ_CP029146.1 | Rhodococcus ruber |
| 33 | 1793085 | 1793342 | - | NC_015702.1 | Parachlamydia acanthamoebae UV-7 |
| 34 | 3084865 | 3085122 | - | NZ_CP054938.1 | Streptomyces harbinensis |
| 35 | 1894405 | 1894659 | + | NZ_AP022583.1 | Mycobacterium noviomagense |
| 36 | 4822669 | 4822923 | - | NZ_AP024310.1 | Mycobacterium heckeshornense |
| 37 | 59122 | 59376 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 38 | 59174 | 59428 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 39 | 4495022 | 4495276 | - | NZ_AP022581.1 | Mycobacterium lacus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015714.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03796.17 | 0.72 | 28 | 995.0 | same-strand | DnaB-like helicase C terminal domain |
| 2 | PF00772.23 | 0.72 | 28 | 995.0 | same-strand | DnaB-like helicase N terminal domain |
| 3 | PF13481.8 | 0.62 | 24 | 1011.5 | same-strand | AAA domain |
| 4 | PF03948.16 | 0.9 | 35 | 68 | same-strand | Ribosomal protein L9, C-terminal domain |
| 5 | PF01281.21 | 0.9 | 35 | 68 | same-strand | Ribosomal protein L9, N-terminal domain |
| 6 | PF00436.27 | 0.79 | 31 | 34 | same-strand | Single-strand binding protein family |
| 7 | PF01250.19 | 0.97 | 38 | 507.0 | same-strand | Ribosomal protein S6 |
++ More..