Result : A3DER9
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | ATP-dependent Clp protease adapter protein ClpS |
| NCBI Accession ID | CP000568.1 |
| Organism | Hungateiclostridium thermocellum (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372) (Clostridium thermocellum) |
| Left | 1449927 |
| Right | 1450226 |
| Strand | + |
| Nucleotide Sequence | ATGTCTGAAAAGACGATAGTTAAAAAAGAAACCAATGTTGACTTTAAAAAGCCCAAAATGTATAAAGTAATCCTTCTTAATGACGACTATACAACAATGGATTTTGTTGTTGAAATACTTATAACGGTTTTTCATAAGACTGCCGCCGATGCCACAAGAATCATGCTTGATGTGCATCGTAAAGGAAAAGGAGTTGTGGGAGTTTATACATATGACATTGCCAGAAGCAAAATAGCTTTGGTGGAAAAAATGGCAGCGGAAAGAGAATTCCCACTTGCAGCTGTTATGGAGCCGGAATAA |
| Sequence | MSEKTIVKKETNVDFKKPKMYKVILLNDDYTTMDFVVEILITVFHKTAADATRIMLDVHRKGKGVVGVYTYDIARSKIALVEKMAAEREFPLAAVMEPE |
| Source of smORF | Swiss-Prot |
| Function | Involved in the modulation of the specificity of the ClpAP-mediated ATP-dependent protein degradation. {ECO:0000255|HAMAP-Rule:MF_00302}. |
| Pubmed ID | |
| Domain | CDD:412656 |
| Functional Category | Others |
| Uniprot ID | A3DER9 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 348
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1251321 | 1251620 | - | NZ_CP016502.1 | Acetivibrio thermocellus DSM 2360 |
| 2 | 3527850 | 3528149 | + | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 3 | 1456168 | 1456467 | - | NZ_CP025197.1 | Acetivibrio saccincola |
| 4 | 278264 | 278506 | + | NZ_CP036150.1 | Oceanispirochaeta crateris |
| 5 | 186905 | 187147 | - | NC_007759.1 | Syntrophus aciditrophicus SB |
| 6 | 1248863 | 1249162 | + | NZ_CP020953.1 | Clostridium drakei |
| 7 | 596701 | 597000 | - | NZ_CP012395.1 | Clostridium autoethanogenum DSM 10061 |
| 8 | 2742512 | 2742811 | - | NC_014328.1 | Clostridium ljungdahlii DSM 13528 |
| 9 | 212196 | 212495 | + | NZ_CP011803.1 | Clostridium carboxidivorans P7 |
| 10 | 3017483 | 3017782 | - | NZ_CP009933.1 | Clostridium scatologenes |
| 11 | 2263344 | 2263643 | - | NC_015732.1 | Treponema caldarium DSM 7334 |
| 12 | 4150431 | 4150673 | - | NZ_CP061799.1 | Desulfonema limicola |
| 13 | 1870853 | 1871152 | + | NZ_AP023212.1 | Hydrogenimonas urashimensis |
| 14 | 1646427 | 1646669 | - | NC_013512.1 | Sulfurospirillum deleyianum DSM 6946 |
| 15 | 1469821 | 1470120 | - | NZ_AP022847.1 | Nitrosophilus alvini |
| 16 | 2029119 | 2029361 | - | NZ_CP017111.1 | Sulfurospirillum halorespirans DSM 13726 |
| 17 | 2182053 | 2182295 | - | NZ_CP007201.1 | Sulfurospirillum multivorans DSM 12446 |
| 18 | 1801615 | 1801914 | - | NC_017187.1 | Aliarcobacter butzleri ED-1 |
| 19 | 398440 | 398754 | - | NZ_CP015136.1 | Luteitalea pratensis |
| 20 | 2901331 | 2901573 | - | NZ_CP013019.1 | Clostridium pasteurianum |
| 21 | 2325517 | 2325816 | - | NC_011837.1 | Clostridium kluyveri NBRC 12016 |
| 22 | 372291 | 372590 | + | NZ_CP063164.1 | Sulfurovum indicum |
| 23 | 2164501 | 2164758 | - | NZ_CP032098.1 | Malaciobacter molluscorum LMG 25693 |
| 24 | 1554112 | 1554411 | - | NZ_AP022826.1 | Nitrosophilus labii |
| 25 | 2142826 | 2143125 | - | NZ_CP032100.1 | Arcobacter suis CECT 7833 |
| 26 | 2238248 | 2238505 | - | NZ_CP042812.1 | Malaciobacter canalis |
| 27 | 2222928 | 2223185 | - | NZ_CP031219.1 | Malaciobacter mytili LMG 24559 |
| 28 | 807651 | 807962 | + | NZ_AP014724.1 | Sulfurospirillum cavolei |
| 29 | 1670934 | 1671230 | - | NC_018002.1 | Sulfurospirillum barnesii SES-3 |
| 30 | 314558 | 314872 | + | NC_016803.1 | Pseudodesulfovibrio mercurii |
| 31 | 2284947 | 2285204 | - | NZ_CP032101.1 | Malaciobacter marinus |
| 32 | 2148805 | 2149047 | + | NZ_CP061800.1 | Desulfonema magnum |
| 33 | 406047 | 406346 | + | NZ_CP053837.1 | Aliarcobacter faecis |
| 34 | 1631096 | 1631395 | - | NZ_CP031367.1 | Aliarcobacter trophiarum LMG 25534 |
| 35 | 1470165 | 1470407 | + | NC_023035.1 | Salinispira pacifica |
| 36 | 1523566 | 1523865 | - | NZ_CP032099.1 | Aliarcobacter skirrowii CCUG 10374 |
| 37 | 2172367 | 2172624 | - | NZ_CP031218.1 | Malaciobacter halophilus |
| 38 | 4612063 | 4612320 | - | NZ_CP011125.1 | Sandaracinus amylolyticus |
| 39 | 488654 | 488929 | + | NZ_CP031217.1 | Halarcobacter bivalviorum |
| 40 | 2048343 | 2048642 | - | NZ_CP030944.1 | Arcobacter aquimarinus |
| 41 | 2206729 | 2206971 | - | NC_017098.1 | Spirochaeta africana DSM 8902 |
| 42 | 2556079 | 2556378 | - | NZ_CP053840.1 | Arcobacter venerupis |
| 43 | 3010756 | 3011013 | - | NC_009943.1 | Desulfococcus oleovorans Hxd3 |
| 44 | 964115 | 964366 | + | NZ_LN614827.1 | Legionella fallonii LLAP-10 |
| 45 | 2376897 | 2377160 | - | NZ_CP041070.1 | Arcobacter anaerophilus |
| 46 | 2020633 | 2020932 | - | NZ_CP035928.1 | Malaciobacter pacificus |
| 47 | 703093 | 703392 | + | NZ_CP054051.1 | Aliarcobacter cibarius |
| 48 | 2289771 | 2290070 | - | NZ_CP032097.1 | Arcobacter ellisii |
| 49 | 446202 | 446501 | + | NZ_CP036246.2 | [Arcobacter] porcinus |
| 50 | 3392339 | 3392584 | - | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
| 51 | 461343 | 461606 | - | NC_007575.1 | Sulfurimonas denitrificans DSM 1251 |
| 52 | 3197514 | 3197831 | + | NC_014972.1 | Desulfobulbus propionicus DSM 2032 |
| 53 | 1732469 | 1732768 | + | NC_014506.1 | Sulfurimonas autotrophica DSM 16294 |
| 54 | 7454968 | 7455291 | + | NC_008095.1 | Myxococcus xanthus DK 1622 |
| 55 | 34078 | 34401 | + | NZ_LR134431.1 | Legionella adelaidensis |
| 56 | 2443294 | 2443593 | - | NZ_CP053836.1 | Halarcobacter ebronensis |
| 57 | 1142546 | 1142809 | - | NZ_CP071057.1 | Marinicauda algicola |
| 58 | 2237367 | 2237678 | + | NC_015577.1 | Treponema azotonutricium ZAS-9 |
| 59 | 398805 | 399107 | - | NC_014212.1 | Meiothermus silvanus DSM 9946 |
| 60 | 860472 | 860765 | - | NZ_CP021886.1 | Helicobacter apodemus |
| 61 | 3261788 | 3262102 | - | NZ_CP046400.1 | Pseudodesulfovibrio cashew |
| 62 | 300184 | 300483 | + | NZ_CP032823.1 | Aliarcobacter cryaerophilus ATCC 43158 |
| 63 | 2485016 | 2485315 | - | NZ_CP053835.1 | Arcobacter defluvii |
| 64 | 2410841 | 2411140 | - | NZ_CP042652.1 | Pseudoarcobacter acticola |
| 65 | 7253973 | 7254296 | + | NZ_CP022203.1 | Corallococcus macrosporus DSM 14697 |
| 66 | 2592603 | 2592851 | - | NC_017964.1 | Advenella kashmirensis WT001 |
| 67 | 426943 | 427242 | - | NZ_LN907858.1 | Helicobacter typhlonius |
| 68 | 1260538 | 1260861 | + | NZ_LN681225.1 | Legionella hackeliae |
| 69 | 1096167 | 1096472 | - | NZ_CP063087.1 | Helicobacter winghamensis |
| 70 | 2149181 | 2149459 | + | NZ_CP022163.1 | Melittangium boletus DSM 14713 |
| 71 | 2458668 | 2458931 | - | NC_014166.1 | Arcobacter nitrofigilis DSM 7299 |
| 72 | 1104094 | 1104342 | + | NZ_CP012418.1 | Kangiella sediminilitoris |
| 73 | 2698644 | 2698886 | - | NC_011768.1 | Desulfatibacillum aliphaticivorans |
| 74 | 1015117 | 1015440 | - | NZ_CP012109.1 | Myxococcus hansupus |
| 75 | 1814019 | 1814267 | + | NZ_CP003915.1 | Advenella mimigardefordensis DPN7 |
| 76 | 2149428 | 2149727 | - | NZ_CP053833.1 | Arcobacter cloacae |
| 77 | 1595319 | 1595624 | - | NC_013223.1 | Desulfohalobium retbaense DSM 5692 |
| 78 | 1975391 | 1975633 | + | NC_015687.1 | Clostridium acetobutylicum DSM 1731 |
| 79 | 2390873 | 2391124 | - | NC_013861.1 | Legionella longbeachae NSW150 |
| 80 | 1115107 | 1115355 | + | NZ_CP010975.1 | Kangiella geojedonensis |
| 81 | 2333601 | 2333918 | - | NZ_AP014936.1 | Sulfurifustis variabilis |
| 82 | 1497586 | 1497831 | - | NC_004917.1 | Helicobacter hepaticus ATCC 51449 |
| 83 | 3043838 | 3044080 | + | NC_012108.1 | Desulfobacterium autotrophicum HRM2 |
| 84 | 911998 | 912312 | - | NZ_LT907975.1 | Pseudodesulfovibrio profundus |
| 85 | 1939954 | 1940253 | - | NC_014762.1 | Sulfuricurvum kujiense DSM 16994 |
| 86 | 56834 | 57076 | + | NC_008554.1 | Syntrophobacter fumaroxidans MPOB |
| 87 | 332950 | 333255 | + | NC_005090.1 | Wolinella succinogenes DSM 1740 |
| 88 | 905912 | 906247 | + | NZ_CP013742.1 | Legionella pneumophila |
| 89 | 685372 | 685620 | - | NC_015161.1 | Deinococcus proteolyticus MRP |
| 90 | 1238796 | 1239038 | + | NZ_CP047349.1 | Proteus terrae subsp. cibarius |
| 91 | 2021837 | 2022088 | - | NZ_CP025491.2 | Legionella sainthelensi |
| 92 | 2968702 | 2968944 | + | NZ_CP029176.1 | Acidibrevibacterium fodinaquatile |
| 93 | 1029658 | 1029900 | - | NZ_CP020867.1 | Campylobacter cuniculorum DSM 23162 = LMG 24588 |
| 94 | 133049 | 133291 | + | NZ_AP021874.1 | Desulfosarcina alkanivorans |
| 95 | 2054742 | 2055065 | - | NZ_CP016397.1 | Legionella clemsonensis |
| 96 | 2149340 | 2149606 | - | NZ_LN614830.1 | Tatlockia micdadei |
| 97 | 1319489 | 1319731 | + | NZ_CP014170.1 | Clostridium tyrobutyricum |
| 98 | 5364631 | 5364963 | - | NZ_CP012159.1 | Chondromyces crocatus |
| 99 | 2518876 | 2519184 | + | NZ_CP026328.2 | Acidithiobacillus caldus |
| 100 | 3547093 | 3547335 | + | NC_018645.1 | Desulfobacula toluolica Tol2 |
| 101 | 1897907 | 1898149 | + | NZ_CP028897.1 | Dongshaea marina |
| 102 | 3196711 | 3197025 | + | NC_016629.1 | Desulfocurvibacter africanus subsp. africanus str. Walvis Bay |
| 103 | 3727609 | 3727851 | - | NZ_CP016171.1 | Bordetella bronchialis |
| 104 | 748910 | 749152 | + | NC_010554.1 | Proteus mirabilis HI4320 |
| 105 | 2061382 | 2061705 | + | NC_014414.1 | Parvularcula bermudensis HTCC2503 |
| 106 | 1583726 | 1583983 | - | NZ_CP072793.1 | Thiothrix unzii |
| 107 | 3137635 | 3137877 | - | NZ_CP031555.1 | Thalassospira indica |
| 108 | 1482529 | 1482771 | - | NC_011144.1 | Phenylobacterium zucineum HLK1 |
| 109 | 539639 | 539932 | + | NC_012115.1 | Nautilia profundicola AmH |
| 110 | 2445285 | 2445530 | + | NZ_CP031500.1 | Deinococcus radiodurans |
| 111 | 1196316 | 1196558 | + | NC_007626.1 | Magnetospirillum magneticum AMB-1 |
| 112 | 3680633 | 3680875 | - | NC_023065.1 | Magnetospirillum gryphiswaldense MSR-1 v2 |
| 113 | 1473217 | 1473459 | - | NZ_CP025120.1 | Kangiella profundi |
| 114 | 3210390 | 3210671 | + | NZ_CP041636.1 | Ferrovibrio terrae |
| 115 | 3750259 | 3750501 | - | NZ_CP023536.1 | Providencia alcalifaciens |
| 116 | 8569131 | 8569454 | + | NC_020126.1 | Myxococcus stipitatus DSM 14675 |
| 117 | 871766 | 872023 | - | NZ_CP053849.1 | Campylobacter upsaliensis RM3940 |
| 118 | 1053098 | 1053340 | - | NZ_CP022347.1 | Campylobacter avium LMG 24591 |
| 119 | 513142 | 513384 | + | NZ_CP030126.1 | Indioceanicola profundi |
| 120 | 1973610 | 1973882 | + | NZ_CP014230.1 | Desulfomicrobium orale DSM 12838 |
| 121 | 739735 | 739977 | - | NZ_CP021081.1 | Deinococcus ficus |
| 122 | 1582715 | 1582957 | + | NZ_CP022110.1 | Nitrospirillum amazonense CBAmc |
| 123 | 1443716 | 1444048 | + | NC_014375.1 | Brevundimonas subvibrioides ATCC 15264 |
| 124 | 2588929 | 2589171 | - | NZ_CP004388.1 | Thalassospira xiamenensis M-5 = DSM 17429 |
| 125 | 1504345 | 1504680 | + | NZ_CP027668.1 | Phreatobacter cathodiphilus |
| 126 | 1572709 | 1572951 | - | NC_013166.1 | Kangiella koreensis DSM 16069 |
| 127 | 893702 | 893944 | - | NZ_CP044117.1 | Roseomonas mucosa |
| 128 | 762043 | 762291 | + | NC_020127.1 | Lawsonia intracellularis N343 |
| 129 | 298605 | 298847 | - | NZ_CP068286.1 | Ralstonia syzygii subsp. celebesensis |
| 130 | 951995 | 952237 | - | NZ_CP011257.1 | Ralstonia mannitolilytica |
| 131 | 1076574 | 1076816 | - | NZ_CP012943.1 | Ralstonia solanacearum |
| 132 | 2794316 | 2794558 | - | NZ_CP016022.1 | Ralstonia insidiosa |
| 133 | 3703331 | 3703606 | + | NZ_CP045201.1 | Pseudopuniceibacterium antarcticum |
| 134 | 2844002 | 2844316 | - | NZ_CP010311.1 | Geoalkalibacter subterraneus |
| 135 | 2334627 | 2334932 | - | NC_018020.1 | Turneriella parva DSM 21527 |
| 136 | 2255982 | 2256305 | - | NZ_CP036422.1 | Halioglobus maricola |
| 137 | 1790541 | 1790783 | + | NZ_CP038033.1 | Nitrosococcus wardiae |
| 138 | 1851503 | 1851778 | + | NZ_CP045508.1 | Desulfolutivibrio sulfoxidireducens |
| 139 | 2622866 | 2623108 | - | NZ_CP054626.1 | Cupriavidus gilardii |
| 140 | 3914202 | 3914444 | - | NZ_CP017754.1 | Cupriavidus malaysiensis |
| 141 | 865467 | 865748 | - | NZ_LR134374.1 | Legionella spiritensis |
| 142 | 2347049 | 2347291 | + | NC_013960.1 | Nitrosococcus halophilus Nc 4 |
| 143 | 1076931 | 1077173 | - | NZ_CP020478.1 | Campylobacter helveticus |
| 144 | 140496 | 140738 | - | NZ_CP014525.1 | Haematospirillum jordaniae |
| 145 | 2343410 | 2343652 | - | NC_016026.1 | Micavibrio aeruginosavorus ARL-13 |
| 146 | 1040211 | 1040453 | + | NC_002163.1 | Campylobacter jejuni subsp. jejuni NCTC 11168 = ATCC 700819 |
| 147 | 1106131 | 1106406 | - | NZ_CP045504.1 | Desulfovibrio sulfodismutans DSM 3696 |
| 148 | 1514521 | 1514763 | - | NC_008789.1 | Halorhodospira halophila SL1 |
| 149 | 1706525 | 1706806 | + | NC_020059.1 | Rhizobium tropici CIAT 899 |
| 150 | 2000429 | 2000704 | - | NC_014844.1 | Pseudodesulfovibrio aespoeensis Aspo-2 |
| 151 | 3976590 | 3976832 | - | NZ_CP030265.1 | Skermanella pratensis |
| 152 | 2541068 | 2541310 | - | NZ_CP024199.1 | Thalassospira marina |
| 153 | 2075055 | 2075297 | + | NZ_AP019378.1 | Bordetella parapertussis |
| 154 | 1801799 | 1802041 | + | NZ_LR134326.1 | Bordetella bronchiseptica |
| 155 | 3917630 | 3917878 | - | NZ_CP019343.1 | Oceanicoccus sagamiensis |
| 156 | 1569417 | 1569659 | + | NZ_CP042582.1 | Hypericibacter adhaerens |
| 157 | 215207 | 215527 | + | NZ_CP034759.1 | Litorilituus sediminis |
| 158 | 1037293 | 1037535 | - | NC_012526.1 | Deinococcus deserti VCD115 |
| 159 | 708106 | 708348 | + | NC_018518.1 | Bordetella pertussis 18323 |
| 160 | 1108581 | 1108823 | + | NZ_CP053848.1 | Campylobacter ornithocola |
| 161 | 1282520 | 1282762 | + | NZ_CP023067.1 | Ensifer sojae CCBAU 05684 |
| 162 | 1224196 | 1224438 | + | NZ_CP034909.1 | Ensifer alkalisoli |
| 163 | 1923724 | 1923966 | + | NC_011566.1 | Shewanella piezotolerans WP3 |
| 164 | 1900039 | 1900281 | - | NC_017310.1 | Desulfovibrio vulgaris RCH1 |
| 165 | 1876156 | 1876404 | + | NZ_CP014544.1 | Zhongshania aliphaticivorans |
| 166 | 2449052 | 2449294 | - | NC_017584.1 | Rhodospirillum rubrum F11 |
| 167 | 1899325 | 1899567 | - | NZ_CP003182.2 | Granulibacter bethesdensis CGDNIH4 |
| 168 | 1524334 | 1524576 | + | NZ_CP042906.1 | Hypericibacter terrae |
| 169 | 767190 | 767432 | - | NZ_CP010554.1 | Rugosibacter aromaticivorans |
| 170 | 3024853 | 3025095 | - | NZ_CP032519.1 | Cupriavidus oxalaticus |
| 171 | 3307169 | 3307411 | - | NZ_CP039287.1 | Cupriavidus necator H16 |
| 172 | 277878 | 278177 | + | NC_014935.1 | Nitratifractor salsuginis DSM 16511 |
| 173 | 1855584 | 1855826 | + | NC_017059.1 | Pararhodospirillum photometricum DSM 122 |
| 174 | 293389 | 293631 | - | NZ_CP031611.1 | Campylobacter hepaticus |
| 175 | 3182531 | 3182773 | - | NZ_CP048796.1 | Providencia vermicola |
| 176 | 3715563 | 3715805 | - | NZ_CP062803.1 | Cupriavidus basilensis |
| 177 | 1628068 | 1628310 | - | NZ_CP043043.1 | Gluconobacter thailandicus |
| 178 | 286837 | 287079 | + | NZ_CP022374.1 | Acetobacter oryzifermentans |
| 179 | 1290476 | 1290718 | + | NZ_CP007773.1 | Campylobacter subantarcticus LMG 24377 |
| 180 | 1970303 | 1970584 | + | NZ_CP032694.1 | Rhizobium jaguaris |
| 181 | 290922 | 291164 | + | NZ_CP042808.1 | Acetobacter oryzoeni |
| 182 | 1851212 | 1851454 | + | NC_021991.1 | Acetobacter pasteurianus 386B |
| 183 | 2283979 | 2284221 | - | NZ_CP015164.1 | Acetobacter ascendens |
| 184 | 1378694 | 1378942 | - | NZ_CP028901.1 | Algicoccus marinus |
| 185 | 3493841 | 3494083 | - | NZ_CP041352.1 | Casimicrobium huifangae |
| 186 | 1304146 | 1304388 | + | NZ_CP015880.1 | Ensifer adhaerens |
| 187 | 673208 | 673450 | + | NZ_CP031123.2 | Providencia huaxiensis |
| 188 | 2794433 | 2794675 | - | NC_010170.1 | Bordetella petrii |
| 189 | 1548654 | 1548896 | - | NZ_AP018724.1 | Sulfurivermis fontis |
| 190 | 779547 | 779798 | + | NZ_CP022987.1 | Pusillimonas thiosulfatoxidans |
| 191 | 2839681 | 2839923 | + | NZ_CP026364.1 | Proteus hauseri |
| 192 | 698616 | 698885 | + | NZ_AP019773.1 | Bartonella quintana |
| 193 | 664872 | 665114 | - | NZ_AP021881.1 | Sulfuriferula nivalis |
| 194 | 2030720 | 2031040 | - | NZ_AP014879.1 | Sulfuricaulis limicola |
| 195 | 2546152 | 2546394 | - | NC_012691.1 | Tolumonas auensis DSM 9187 |
| 196 | 154468 | 154782 | + | NZ_CP040098.1 | Desulfoglaeba alkanexedens ALDC |
| 197 | 2914079 | 2914387 | - | NC_014216.1 | Desulfurivibrio alkaliphilus AHT 2 |
| 198 | 9011 | 9319 | - | NZ_CP014646.1 | Thauera humireducens |
| 199 | 1997142 | 1997390 | + | NZ_CP016211.1 | Minicystis rosea |
| 200 | 611535 | 611777 | + | NZ_CP038141.1 | Swingsia samuiensis |
| 201 | 2944666 | 2944908 | - | NZ_CP014143.1 | Microbulbifer aggregans |
| 202 | 456880 | 457122 | - | NZ_CP029829.1 | Azospirillum ramasamyi |
| 203 | 2383902 | 2384144 | + | NZ_CP054619.1 | Azospirillum oryzae |
| 204 | 849822 | 850100 | + | NC_012846.1 | Bartonella grahamii as4aup |
| 205 | 2510007 | 2510330 | - | NZ_CP060436.1 | Pseudooceanicola algae |
| 206 | 2401303 | 2401548 | + | NC_007645.1 | Hahella chejuensis KCTC 2396 |
| 207 | 210843 | 211085 | + | NZ_CP012401.1 | Azospirillum thiophilum |
| 208 | 2150774 | 2151088 | - | NC_007519.1 | Desulfovibrio alaskensis G20 |
| 209 | 598364 | 598606 | + | NC_021287.1 | Caballeronia insecticola |
| 210 | 2866889 | 2867203 | + | NZ_CP045696.1 | Sodaliphilus pleomorphus |
| 211 | 1054525 | 1054767 | + | NZ_CP053825.1 | Campylobacter armoricus |
| 212 | 3078121 | 3078363 | - | NZ_CP025086.1 | Methylovirgula ligni |
| 213 | 2228695 | 2229009 | - | NC_014541.1 | Ferrimonas balearica DSM 9799 |
| 214 | 2750406 | 2750663 | - | NC_014958.1 | Deinococcus maricopensis DSM 21211 |
| 215 | 2149787 | 2150029 | + | NZ_CP060244.1 | Entomobacter blattae |
| 216 | 1959504 | 1959797 | - | NZ_CP024201.1 | Caulobacter mirabilis |
| 217 | 860784 | 861044 | + | NZ_CP017715.1 | Marinobacter salinus |
| 218 | 3005016 | 3005261 | - | NC_010995.1 | Cellvibrio japonicus Ueda107 |
| 219 | 994150 | 994392 | + | NZ_CP053856.1 | Rhizobium pusense |
| 220 | 997640 | 997882 | + | NZ_CP061003.1 | Agrobacterium tumefaciens |
| 221 | 737524 | 737766 | - | NZ_CP048632.1 | Rhizobium oryzihabitans |
| 222 | 119332 | 119574 | + | NZ_CP063079.1 | Campylobacter peloridis |
| 223 | 3763129 | 3763371 | - | NZ_CP019948.1 | Methylocystis bryophila |
| 224 | 4506668 | 4506910 | + | NZ_CP036200.1 | Shewanella maritima |
| 225 | 3084639 | 3084881 | - | NC_009901.1 | Shewanella pealeana ATCC 700345 |
| 226 | 2044268 | 2044510 | - | NZ_LN832559.1 | Paracoccus aminovorans |
| 227 | 3676924 | 3677175 | + | NZ_CP013119.1 | Alcaligenes faecalis |
| 228 | 1889432 | 1889674 | - | NZ_CP031415.1 | Saccharospirillum mangrovi |
| 229 | 1812126 | 1812371 | - | NZ_CP029822.1 | Entomomonas moraniae |
| 230 | 2448139 | 2448381 | - | NZ_CP046909.1 | Paraburkholderia acidiphila |
| 231 | 2151881 | 2152123 | + | NC_018691.1 | Alcanivorax dieselolei B5 |
| 232 | 2467879 | 2468121 | - | NZ_CP012371.1 | Nitrosospira briensis C-128 |
| 233 | 943535 | 943792 | + | NZ_CP071517.1 | Lysobacter arenosi |
| 234 | 2431794 | 2432036 | - | NZ_CP046913.1 | Paraburkholderia acidisoli |
| 235 | 2499085 | 2499327 | - | NZ_CP049134.1 | Paraburkholderia tropica |
| 236 | 3211233 | 3211478 | - | NZ_CP043575.1 | Comamonas koreensis |
| 237 | 1711244 | 1711486 | - | NZ_CP029347.1 | Saliniradius amylolyticus |
| 238 | 3230320 | 3230562 | - | NZ_CP024941.1 | Paraburkholderia terricola |
| 239 | 656922 | 657164 | + | NC_017956.1 | Tistrella mobilis KA081020-065 |
| 240 | 2333900 | 2334178 | - | NZ_CP045423.1 | Microvirga thermotolerans |
| 241 | 917786 | 918037 | + | NZ_CP040463.1 | Caminibacter mediatlanticus TB-2 |
| 242 | 31139 | 31381 | + | NZ_CP017561.1 | Paraburkholderia sprentiae WSM5005 |
| 243 | 877142 | 877384 | + | NC_007651.1 | Burkholderia thailandensis E264 |
| 244 | 801248 | 801490 | - | NZ_CP009555.1 | Burkholderia oklahomensis C6786 |
| 245 | 3487120 | 3487362 | + | NZ_CP066075.1 | Paraburkholderia ginsengisoli |
| 246 | 3198881 | 3199123 | - | NZ_CP024934.1 | Paraburkholderia graminis |
| 247 | 997850 | 998092 | + | NZ_CP012621.1 | Zobellella denitrificans |
| 248 | 1989351 | 1989593 | + | NZ_CP022989.1 | Paraburkholderia aromaticivorans |
| 249 | 1319480 | 1319722 | - | NZ_CP031467.1 | Paraburkholderia caffeinilytica |
| 250 | 3996130 | 3996372 | - | NC_007951.1 | Paraburkholderia xenovorans LB400 |
| 251 | 1398427 | 1398669 | + | NC_017790.1 | Deinococcus gobiensis I-0 |
| 252 | 1156405 | 1156647 | + | NZ_CP060084.1 | Teredinibacter haidensis |
| 253 | 2302758 | 2303000 | - | NZ_AP021884.1 | Sulfuriferula plumbiphila |
| 254 | 1122475 | 1122717 | - | NZ_CP011412.1 | Sedimenticola thiotaurini |
| 255 | 695424 | 695666 | - | NC_018868.3 | Simiduia agarivorans SA1 = DSM 21679 |
| 256 | 894924 | 895226 | + | NZ_CP059564.1 | Alysiella filiformis |
| 257 | 2103603 | 2103857 | - | NZ_CP019650.1 | Microbulbifer agarilyticus |
| 258 | 2528404 | 2528649 | + | NZ_CP068551.1 | Pseudomonas khazarica |
| 259 | 1599943 | 1600185 | + | NZ_CP011930.1 | Herbaspirillum seropedicae |
| 260 | 1430672 | 1430914 | + | NZ_CP013737.1 | Herbaspirillum rubrisubalbicans M1 |
| 261 | 1574767 | 1575009 | + | NZ_CP037993.1 | Herbaspirillum huttiense |
| 262 | 612975 | 613217 | + | NZ_CP009795.1 | Burkholderia dolosa AU0158 |
| 263 | 2836647 | 2836889 | - | NZ_CP009832.1 | Burkholderia multivorans ATCC BAA-247 |
| 264 | 2799357 | 2799599 | - | NZ_CP013398.1 | Burkholderia seminalis |
| 265 | 2869450 | 2869692 | - | NZ_CP013401.1 | Burkholderia metallica |
| 266 | 566531 | 566773 | - | NZ_CP011503.1 | Burkholderia pyrrocinia |
| 267 | 2872899 | 2873141 | - | NZ_CP013450.1 | Burkholderia cenocepacia |
| 268 | 2941661 | 2941903 | - | NZ_CP045235.1 | Burkholderia cepacia |
| 269 | 2968352 | 2968594 | - | NC_007510.1 | Burkholderia lata |
| 270 | 3013734 | 3013976 | - | NZ_CP013459.1 | Burkholderia stagnalis |
| 271 | 2964197 | 2964454 | - | NZ_CP020737.1 | Paraburkholderia acidophila |
| 272 | 3182094 | 3182336 | - | NZ_CP013414.1 | Burkholderia ubonensis |
| 273 | 3567171 | 3567413 | - | NC_010681.1 | Paraburkholderia phytofirmans PsJN |
| 274 | 3567519 | 3567761 | + | NZ_LT671418.1 | Herminiimonas arsenitoxidans |
| 275 | 3477416 | 3477658 | - | NZ_CP002580.1 | Burkholderia plantarii |
| 276 | 2154761 | 2155003 | + | NC_007912.1 | Saccharophagus degradans 2-40 |
| 277 | 2134101 | 2134343 | - | NZ_CP018845.1 | Herbaspirillum robiniae |
| 278 | 43115 | 43396 | - | NZ_CP060820.1 | Lysobacter solisilvae (ex Woo and Kim 2020) |
| 279 | 2552778 | 2553020 | + | NC_007614.1 | Nitrosospira multiformis ATCC 25196 |
| 280 | 1600179 | 1600421 | - | NZ_CP035900.1 | Burkholderia glumae |
| 281 | 1232709 | 1232951 | + | NZ_CP009727.1 | Burkholderia mallei |
| 282 | 798834 | 799076 | - | NZ_CP008781.1 | Burkholderia pseudomallei |
| 283 | 869048 | 869326 | + | NZ_CP029556.1 | Lysobacter oculi |
| 284 | 3633970 | 3634278 | + | NZ_CP064781.1 | Azospira restricta |
| 285 | 1212788 | 1213030 | + | NZ_CP033078.1 | Vibrio zhugei |
| 286 | 977966 | 978208 | + | NZ_CP007770.1 | Campylobacter insulaenigrae NCTC 12927 |
| 287 | 2719777 | 2720019 | + | NZ_CP037952.1 | Parashewanella spongiae |
| 288 | 5580284 | 5580568 | - | NZ_CP018632.1 | Granulosicoccus antarcticus IMCC3135 |
| 289 | 2177247 | 2177522 | - | NZ_CP049037.1 | Pseudohalocynthiibacter aestuariivivens |
| 290 | 1614464 | 1614706 | + | NZ_CP013107.1 | Sinorhizobium americanum |
| 291 | 886889 | 887158 | + | NZ_CP045871.1 | Litoricola lipolytica |
| 292 | 1458499 | 1458741 | + | NC_008260.1 | Alcanivorax borkumensis SK2 |
| 293 | 861755 | 861997 | + | NZ_CP011389.1 | Deinococcus soli (ex Cha et al. 2016) |
| 294 | 1283219 | 1283461 | + | NZ_CP013236.1 | Collimonas pratensis |
| 295 | 2826522 | 2826764 | - | NZ_CP029494.1 | Deinococcus irradiatisoli |
| 296 | 1137964 | 1138206 | + | NZ_CP013235.1 | Collimonas arenae |
| 297 | 4269970 | 4270212 | - | NZ_CP013232.1 | Collimonas fungivorans |
| 298 | 233678 | 233920 | - | NZ_CP045073.1 | Paracoccus kondratievae |
| 299 | 758390 | 758689 | - | NZ_CP010995.1 | Campylobacter iguaniorum |
| 300 | 2219290 | 2219532 | + | NZ_CP013910.1 | Deinococcus actinosclerus |
| 301 | 2182520 | 2182774 | - | NZ_CP047491.1 | Microbulbifer hydrolyticus |
| 302 | 3858499 | 3858777 | - | NC_003911.12 | Ruegeria pomeroyi DSS-3 |
| 303 | 1539532 | 1539774 | + | NZ_FO704550.1 | Xenorhabdus doucetiae |
| 304 | 2460151 | 2460396 | - | NZ_LR215729.2 | Pseudomonas marincola |
| 305 | 2280965 | 2281207 | + | NZ_CP028324.1 | Massilia armeniaca |
| 306 | 1175115 | 1175357 | + | NZ_AP019700.1 | Stella humosa |
| 307 | 1330886 | 1331128 | - | NZ_CP010028.1 | Deinococcus radiopugnans |
| 308 | 2733844 | 2734086 | + | NZ_CP043473.1 | Chromobacterium paludis |
| 309 | 1216338 | 1216619 | + | NZ_CP054020.1 | Thiomicrorhabdus xiamenensis |
| 310 | 2547770 | 2548012 | - | NZ_CP061202.1 | Rhodobacter capsulatus |
| 311 | 1527148 | 1527444 | - | NZ_CP051180.1 | Ferrimonas lipolytica |
| 312 | 2165388 | 2165645 | + | NZ_CP023406.1 | Luteimonas chenhongjianii |
| 313 | 3969550 | 3969792 | + | NC_005085.1 | Chromobacterium violaceum ATCC 12472 |
| 314 | 685215 | 685457 | + | NZ_CP029495.1 | Chromobacterium phragmitis |
| 315 | 775279 | 775587 | + | NZ_AP018738.1 | Ferriphaselus amnicola |
| 316 | 3140639 | 3140881 | + | NZ_CP021106.3 | Nitrosospira lacus |
| 317 | 757483 | 757746 | + | NZ_CP027432.2 | Caminibacter pacificus |
| 318 | 1956171 | 1956416 | + | NZ_CP051298.1 | Alicycliphilus denitrificans |
| 319 | 5886395 | 5886637 | + | NZ_CP019038.1 | Massilia putida |
| 320 | 2154177 | 2154419 | - | NZ_FO704551.1 | Xenorhabdus poinarii G6 |
| 321 | 2467719 | 2468027 | + | NZ_CP028339.1 | Thauera aromatica K172 |
| 322 | 7243680 | 7243982 | - | NZ_CP024608.1 | Massilia violaceinigra |
| 323 | 1900669 | 1900929 | + | NZ_CP048832.1 | Janthinobacterium lividum |
| 324 | 254736 | 254978 | - | NZ_CP037953.1 | Permianibacter aggregans |
| 325 | 3504368 | 3504676 | + | NZ_CP018839.1 | Thauera chlorobenzoica |
| 326 | 3347458 | 3347700 | - | NZ_CP019437.1 | Thioclava nitratireducens |
| 327 | 513613 | 513855 | + | NC_014722.1 | Mycetohabitans rhizoxinica HKI 454 |
| 328 | 1973129 | 1973389 | + | NZ_CP023422.1 | Janthinobacterium svalbardensis |
| 329 | 5746429 | 5746689 | + | NZ_CP041185.1 | Janthinobacterium tructae |
| 330 | 1304760 | 1305002 | - | NZ_CP016210.1 | Azoarcus olearius |
| 331 | 1981724 | 1981966 | + | NZ_CP017707.1 | Chromobacterium vaccinii |
| 332 | 1970042 | 1970287 | - | NZ_CP035934.2 | Acinetobacter cumulans |
| 333 | 1728543 | 1728791 | + | NZ_CP019239.1 | Rhodoferax saidenbachensis |
| 334 | 1114348 | 1114590 | - | NZ_AP012547.1 | Sulfuritalea hydrogenivorans sk43H |
| 335 | 1203987 | 1204295 | + | NZ_CP059560.1 | Aromatoleum petrolei |
| 336 | 834704 | 834946 | - | NZ_CP029331.1 | Thauera hydrothermalis |
| 337 | 188805 | 189107 | + | NZ_CP019448.1 | Simonsiella muelleri ATCC 29453 |
| 338 | 3042596 | 3042904 | - | NZ_CP059467.1 | Aromatoleum bremense |
| 339 | 1126796 | 1127038 | + | NZ_CP039700.1 | Vibrio cyclitrophicus |
| 340 | 2657524 | 2657832 | - | NC_006513.1 | Aromatoleum aromaticum EbN1 |
| 341 | 1946164 | 1946478 | + | NZ_CP059565.1 | Neisseria wadsworthii |
| 342 | 2512316 | 2512576 | + | NZ_CP048878.1 | Spartinivicinus ruber |
| 343 | 1714642 | 1714956 | + | NZ_LR134313.1 | Neisseria canis |
| 344 | 1726863 | 1727135 | - | NZ_CP012028.1 | Neisseria gonorrhoeae |
| 345 | 483943 | 484215 | - | NZ_CP021520.1 | Neisseria meningitidis |
| 346 | 2087651 | 2087965 | + | NZ_CP022278.1 | Neisseria chenwenguii |
| 347 | 1788095 | 1788397 | - | NZ_CP031325.1 | Neisseria polysaccharea |
| 348 | 452470 | 452772 | - | NZ_LS483369.1 | Neisseria cinerea |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP016502.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07724.16 | 0.97 | 336 | 5 | same-strand | AAA domain (Cdc48 subfamily) |
| 2 | PF17871.3 | 0.96 | 334 | 4 | same-strand | AAA lid domain |
| 3 | PF00004.31 | 0.97 | 338 | 5.5 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 4 | PF07728.16 | 0.97 | 336 | 5 | same-strand | AAA domain (dynein-related subfamily) |
| 5 | PF10431.11 | 0.96 | 334 | 4 | same-strand | C-terminal, D2-small domain, of ClpB protein |
| 6 | PF02861.22 | 0.92 | 320 | 6 | same-strand | Clp amino terminal domain, pathogenicity island component |
++ More..