ProsmORF-pred
Result : O53353
Protein Information
Information Type Description
Protein name Transcriptional regulator WhiB2 (Probable chaperone WhiB2)
NCBI Accession ID AL123456.3
Organism Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Left 3639872
Right 3640141
Strand -
Nucleotide Sequence TTGGTTCCCGAGGCGCCGGCGCCATTCGAGGAACCTCTGCCGCCGGAAGCCACCGACCAATGGCAGGACCGTGCGCTATGTGCGCAAACGGATCCCGAAGCGTTCTTCCCGGAGAAGGGCGGCTCCACGCGTGAGGCCAAGAAGATTTGCATGGGCTGCGAGGTGCGGCACGAGTGTCTGGAGTACGCCCTGGCTCATGACGAGCGGTTCGGCATCTGGGGTGGTCTTTCCGAACGCGAGCGCCGCCGCCTCAAACGCGGGATCATCTGA
Sequence MVPEAPAPFEEPLPPEATDQWQDRALCAQTDPEAFFPEKGGSTREAKKICMGCEVRHECLEYALAHDERFGIWGGLSERERRRLKRGII
Source of smORF Swiss-Prot
Function Acts as a transcriptional regulator. Probably redox-responsive. The apo- but not holo-form probably binds DNA (By similarity). {ECO:0000250}.; The apo-form functions as a chaperone, preventing aggregation or helping in correct refolding of a number of substrates; this activity does not require ATP or the ability to bind a Fe-S cluster. Chaperone activity is insensitive to the redox state of its cysteine residues. The apo-form has no protein disulfide reductase activity. The apo-form binds to its own promoter. {ECO:0000269|Pubmed:19016840, ECO:0000269|Pubmed:22686939}.
Pubmed ID 9634230 19016840 20545868 22686939
Domain CDD:396843
Functional Category DNA-binding_and_Metal-binding
Uniprot ID O53353
ORF Length (Amino Acid) 89
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 178
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 3639872 3640141 - NC_000962.3 Mycobacterium tuberculosis H37Rv
2 3697157 3697426 - NC_015848.1 Mycobacterium canettii CIPT 140010059
3 1243535 1243807 + NZ_AP018164.1 Mycobacterium shigaense
4 932983 933255 - NZ_AP022615.1 Mycobacterium heidelbergense
5 3186803 3187075 - NZ_AP022590.1 Mycobacterium mantenii
6 4146229 4146501 - NZ_CP009360.4 Mycobacterium avium subsp. hominissuis
7 454916 455185 + NZ_AP022581.1 Mycobacterium lacus
8 882066 882335 + NZ_CP029543.1 Mycobacterium leprae
9 1348664 1348945 + NZ_LR130759.1 Mycobacterium basiliense
10 4297279 4297551 - NC_016946.1 Mycobacterium intracellulare ATCC 13950
11 4431606 4431878 - NC_016948.1 Mycobacterium paraintracellulare
12 4185793 4186065 - NZ_CP023147.1 Mycobacterium marseillense
13 2714330 2714599 - NZ_AP022575.1 Mycobacterium shinjukuense
14 5281547 5281819 + NZ_AP022619.1 Mycobacterium paraseoulense
15 3079145 3079378 - NZ_AP022614.1 Mycobacterium parmense
16 5469618 5469890 + NZ_AP022582.1 Mycobacterium seoulense
17 1541140 1541391 + NZ_CP025546.1 Mycobacterium paragordonae
18 1014895 1015164 + NZ_CP011883.2 Mycobacterium haemophilum DSM 44634
19 2326786 2327064 - NZ_AP022576.1 Mycobacterium florentinum
20 5129790 5130059 + NZ_AP022573.1 Mycobacterium saskatchewanense
21 5827539 5827820 - NZ_AP022572.1 Mycobacterium shottsii
22 1590779 1591060 + NZ_AP018410.1 Mycobacterium pseudoshottsii JCM 15466
23 2982039 2982320 + NZ_CP058277.1 Mycobacterium marinum
24 2983362 2983625 + NZ_AP022583.1 Mycobacterium noviomagense
25 1402099 1402371 - NZ_AP022568.1 Mycobacterium simiae
26 3753836 3754060 - NZ_AP024310.1 Mycobacterium heckeshornense
27 915642 915932 + NZ_AP022613.1 Mycobacterium conspicuum
28 307773 308024 - NZ_AP022606.1 Mycobacterium branderi
29 4766564 4766830 + NZ_AP022569.1 Mycobacterium cookii
30 1271021 1271275 + NZ_LT906483.1 Mycolicibacterium thermoresistibile
31 378043 378306 - NZ_AP022595.1 Mycolicibacterium sarraceniae
32 5931700 5931966 - NZ_AP022598.1 Mycolicibacterium parafortuitum
33 1210820 1211074 + NC_014158.1 Tsukamurella paurometabola DSM 20162
34 1333615 1333869 + NZ_CP019066.1 Tsukamurella tyrosinosolvens
35 2961386 2961664 - NZ_AP022586.1 Mycolicibacterium litorale
36 3426399 3426677 - NZ_AP022617.1 Mycolicibacterium monacense
37 2018158 2018421 - NZ_AP022565.1 Mycolicibacterium alvei
38 3942405 3942656 - NZ_CP022208.1 Rhodococcus pyridinivorans
39 3600223 3600474 - NZ_LT906450.1 Rhodococcus rhodochrous
40 1346244 1346507 + NZ_AP022561.1 Mycolicibacterium aichiense
41 2273437 2273670 + NZ_AP023172.1 Rhodococcus qingshengii
42 2762100 2762354 - NZ_CP048813.1 Rhodococcus triatomae
43 3860734 3861000 + NZ_AP022596.1 Mycolicibacterium helvum
44 3763816 3764049 - NZ_CP027793.1 Rhodococcus hoagii
45 545461 545730 + NZ_LR026975.1 Mycolicibacterium hassiacum DSM 44199
46 5584770 5585024 + NZ_AP022616.1 Mycolicibacterium phocaicum
47 2593774 2594076 - NZ_AP022609.1 Mycolicibacter hiberniae
48 1978862 1979098 + NZ_LN831039.1 Mycolicibacterium smegmatis
49 2943867 2944133 - NZ_AP022563.1 Mycolicibacterium duvalii
50 47505 47738 - NZ_CP015235.1 Rhodococcus fascians D188
51 4065587 4065844 - NZ_CP011530.1 Mycobacteroides immunogenum
52 3386140 3386403 - NZ_CP029146.1 Rhodococcus ruber
53 6373371 6373625 - NZ_CP012150.1 Mycobacterium goodii
54 3663962 3664216 - NZ_CP014955.1 Mycobacteroides abscessus
55 1480892 1481161 + NZ_LR134356.1 Mycolicibacterium aurum
56 4866673 4866930 + NZ_AP022567.1 Mycolicibacterium mageritense
57 934373 934651 + NZ_CP041695.1 Nocardia otitidiscaviarum
58 4408030 4408287 - NZ_CP041695.1 Nocardia otitidiscaviarum
59 5368593 5368850 - NZ_CP020809.1 Mycobacterium dioxanotrophicus
60 740594 740899 - NZ_AP022589.1 Mycolicibacter minnesotensis
61 4218734 4218961 + NZ_LS483468.1 Rhodococcus coprophilus
62 4197586 4197840 - NZ_CP062008.1 Mycolicibacterium mucogenicum DSM 44124
63 3362619 3362873 - NZ_CP010271.1 Mycobacteroides saopaulense
64 2444084 2444338 + NZ_CP027114.1 Gordonia alkanivorans
65 5826201 5826458 - NZ_AP022579.1 Mycolicibacterium boenickei
66 1289974 1290228 + NZ_CP011853.1 Gordonia phthalatica
67 3651937 3652191 - NZ_AP022612.1 Mycolicibacterium confluentis
68 1521327 1521590 + NZ_CP011491.1 Mycolicibacterium vaccae 95051
69 5530965 5531222 + NZ_AP022620.1 Mycolicibacterium anyangense
70 3701254 3701508 - NZ_AP018165.1 [Mycobacterium] stephanolepidis
71 3691682 3691936 - NZ_CP007220.1 Mycobacteroides chelonae CCUG 47445
72 1842409 1842678 + NC_008726.1 Mycolicibacterium vanbaalenii PYR-1
73 793436 793666 - NZ_AP022599.1 Mycolicibacterium pulveris
74 2598905 2599159 + NZ_CP059694.1 Gordonia rubripertincta
75 3655619 3655873 - NZ_LR134355.1 Mycolicibacterium chitae
76 3179609 3179863 - NZ_CP027433.1 Gordonia iterans
77 3532041 3532295 - NC_013441.1 Gordonia bronchialis DSM 43247
78 2559803 2560084 - NZ_AP022608.1 Mycolicibacterium gadium
79 5205933 5206205 - NZ_AP022560.1 Mycolicibacterium moriokaense
80 5829544 5829825 + NZ_AP022601.1 Mycobacterium gallinarum
81 3429060 3429314 - NZ_CP024633.1 Mycobacteroides salmoniphilum
82 5657890 5658144 + NZ_CP060404.1 Streptomyces buecherae
83 5731161 5731403 + NZ_CP023688.1 Streptomyces rimosus
84 5187205 5187468 + NZ_CP032698.1 Streptomyces hundungensis
85 2866815 2867078 - NZ_CP020700.1 Streptomyces tsukubensis
86 2750037 2750300 - NZ_CP042266.1 Streptomyces qinzhouensis
87 5008137 5008421 - NZ_CP015163.1 Amycolatopsis albispora
88 1562099 1562356 + NZ_AP022610.1 Mycolicibacterium madagascariense
89 4353200 4353463 + NZ_CP065253.1 Streptomyces clavuligerus
90 766943 767191 - NZ_CP065253.1 Streptomyces clavuligerus
91 7514246 7514509 + NZ_CP031142.1 Saccharopolyspora pogona
92 2605681 2605944 - NZ_CP031194.1 Streptomyces paludis
93 3816571 3816813 - NZ_CP020569.1 Streptomyces gilvosporeus
94 6106504 6106767 - NZ_CP030862.1 Streptomyces globosus
95 2271410 2271673 - NC_020990.1 Streptomyces albidoflavus
96 2700387 2700650 - NZ_CP031742.1 Streptomyces koyangensis
97 4607303 4607566 + NZ_CP023701.1 Streptomyces subrutilus
98 4534675 4534938 + NZ_CP023692.1 Streptomyces vinaceus
99 3068462 3068704 - NZ_CP072931.1 Streptomyces auratus AGR0001
100 3457808 3458050 - NZ_CP019457.1 Streptomyces lydicus
101 3535614 3535856 - NZ_CP023691.1 Streptomyces platensis
102 3867478 3867741 - NZ_CP071139.1 Streptomyces nojiriensis
103 5756075 5756338 + NZ_AP023440.1 Streptomyces glomeroaurantiacus
104 4246224 4246466 - NZ_CP070326.1 Streptomyces noursei
105 2939092 2939355 - NZ_CP072827.1 Streptomyces mobaraensis NBRC 13819 = DSM 40847
106 4408712 4408954 + NZ_CP023202.1 Streptomyces xinghaiensis S187
107 4472183 4472437 + NZ_CP034279.1 Streptomyces ficellus
108 1062467 1062718 - NZ_CP034279.1 Streptomyces ficellus
109 2991545 2991808 - NC_021177.1 Streptomyces fulvissimus DSM 40593
110 7283356 7283595 + NC_021177.1 Streptomyces fulvissimus DSM 40593
111 1097672 1097908 + NZ_CP015961.1 Dietzia timorensis
112 7286268 7286516 - NZ_CP023445.1 Actinosynnema pretiosum
113 7424259 7424507 - NC_013093.1 Actinosynnema mirum DSM 43827
114 2908347 2908610 - NZ_CP040752.1 Streptomyces rectiverticillatus
115 4263238 4263501 - NZ_CP031455.1 Streptomyces olivoreticuli subsp. olivoreticuli
116 2599303 2599566 - NZ_CP054938.1 Streptomyces harbinensis
117 2667723 2667986 - NZ_CP024957.1 Streptomyces cavourensis
118 6820179 6820418 + NZ_CP024957.1 Streptomyces cavourensis
119 5596686 5596940 - NC_016582.1 Streptomyces bingchenggensis BCW-1
120 2790194 2790457 - NZ_CP020563.1 Kitasatospora albolonga
121 4904206 4904460 - NZ_CP065050.1 Streptomyces solisilvae
122 1988373 1988636 - NZ_CP009922.3 Streptomyces xiamenensis
123 4162782 4163045 - NZ_CP023690.1 Streptomyces spectabilis
124 2319068 2319331 - NZ_CP029188.1 Streptomyces tirandamycinicus
125 1050201 1050455 + NZ_CP011502.1 Aeromicrobium erythreum
126 3035018 3035281 - NZ_CP013738.1 Streptomyces globisporus C-1027
127 5269039 5269302 + NC_010572.1 Streptomyces griseus subsp. griseus NBRC 13350
128 2893417 2893680 - NZ_CP070242.1 Streptomyces californicus
129 4728122 4728385 + NZ_CP023702.1 Streptomyces nitrosporeus
130 5247307 5247570 + NZ_CP011340.1 Streptomyces pristinaespiralis
131 1256759 1257010 - NZ_CP011340.1 Streptomyces pristinaespiralis
132 1578067 1578312 - NZ_CP017248.1 Streptomyces fodineus
133 6445227 6445472 + NZ_CP021080.1 Streptomyces pluripotens
134 3059907 3060161 - NZ_CP023693.1 Streptomyces cinereoruber
135 6331198 6331455 + NZ_CP023693.1 Streptomyces cinereoruber
136 2328687 2328956 - NZ_CP013290.1 Janibacter indicus
137 2015215 2015478 - NZ_CP029254.1 Streptomyces spongiicola
138 6518332 6518592 + NZ_CP029254.1 Streptomyces spongiicola
139 2904262 2904516 - NZ_CP029196.1 Streptomyces venezuelae
140 6627210 6627467 + NZ_CP029196.1 Streptomyces venezuelae
141 3357293 3357547 - NZ_CP010407.1 Streptomyces vietnamensis
142 6967127 6967384 + NZ_CP010407.1 Streptomyces vietnamensis
143 3675955 3676218 - NZ_CP027306.1 Streptomyces atratus
144 3586384 3586638 - NZ_CP059991.1 Streptomyces gardneri
145 1647196 1647444 - NZ_CP032427.1 Streptomyces griseorubiginosus
146 7408317 7408580 - NZ_CP051486.1 Streptomyces pratensis
147 7039045 7039266 + NZ_CP063374.1 Streptomyces chromofuscus
148 6834447 6834695 + NZ_CP010849.1 Streptomyces cyaneogriseus subsp. noncyanogenus
149 2164168 2164431 - NC_016111.1 Streptomyces cattleya NRRL 8057 = DSM 46488
150 1688118 1688420 - NZ_CP012117.1 Dermabacter vaginalis
151 10068400 10068627 - NZ_CP034550.1 Saccharothrix syringae
152 2095513 2095758 - NZ_CP030073.1 Streptomyces cadmiisoli
153 4648795 4649046 - NC_013510.1 Thermomonospora curvata DSM 43183
154 1382182 1382430 - NZ_LN831790.1 Streptomyces leeuwenhoekii
155 2669705 2669959 - NZ_CP026952.1 Aeromicrobium chenweiae
156 2289723 2289956 + NZ_CP068168.1 Corynebacterium amycolatum
157 642974 643252 + NZ_CP011541.1 Corynebacterium epidermidicanis
158 3224492 3224773 + NZ_CP047156.1 Epidermidibacterium keratini
159 5560810 5561034 - NZ_CP022753.1 Nocardiopsis gilva YIM 90087
160 2720358 2720615 + NZ_CP038436.1 Nocardioides seonyuensis
161 835098 835331 - NZ_AP019307.1 Nocardioides baekrokdamisoli
162 2070336 2070626 + NZ_LT906443.1 Corynebacterium ulcerans
163 1774690 1774944 - NZ_CP060789.1 Tessaracoccus defluvii
164 652821 653084 + NZ_CP006841.1 Corynebacterium lactis RW2-5
165 2776995 2777252 + NZ_CP019607.1 Tessaracoccus flavescens
166 1837139 1837360 - NZ_LT906473.1 Corynebacterium cystitidis
167 1142101 1142352 + NZ_CP038267.1 Nocardioides euryhalodurans
168 675847 676080 + NZ_LT906467.1 Corynebacterium imitans
169 845402 845620 + NZ_CP017812.1 Boudabousia tangfeifanii
170 348757 348990 + NC_022198.1 Corynebacterium argentoratense DSM 44202
171 1460326 1460586 - NZ_CP032788.1 Corynebacterium xerosis
172 5107554 5107808 - NZ_AP022574.1 Mycolicibacterium psychrotolerans
173 2589740 2589994 + NZ_CP035494.1 Microbacterium protaetiae
174 3601350 3601604 + NZ_AP022600.1 Mycolicibacterium tokaiense
175 4042436 4042726 - NZ_CP045929.1 Saccharopolyspora coralli
176 2759163 2759420 + NZ_CP043474.1 Mycobacterium grossiae
177 1967636 1967893 - NZ_CP035495.1 Xylanimonas allomyrinae
178 1474950 1475219 + NZ_LT906453.1 Dermatophilus congolensis
179 868648 868872 + NZ_CP006712.1 Bifidobacterium breve JCM 7017
180 1441569 1441832 + NZ_CP009312.1 Lawsonella clevelandensis
181 158999 159289 - NC_009806.1 Kineococcus radiotolerans SRS30216 = ATCC BAA-149
182 1034933 1035208 + NC_013521.1 Sanguibacter keddieii DSM 10542
183 3603161 3603427 - NZ_CP036250.1 Egicoccus halophilus
184 823818 824120 + NZ_LR131272.1 Arthrobacter agilis
185 1660253 1660522 - NZ_CP030033.1 Cryobacterium soli
186 1007140 1007361 - NZ_CP006018.1 Bifidobacterium indicum LMG 11587 = DSM 20214
187 1026911 1027132 - NZ_CP007287.1 Bifidobacterium coryneforme
188 1896490 1896786 - NZ_CP061538.1 Rothia amarae
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_000962.3
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF02878.18 0.78 139 1225 same-strand Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I
2 PF02880.18 0.78 139 1225 same-strand Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III
3 PF02879.18 0.78 139 1225 same-strand Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II
4 PF00408.22 0.76 136 1227.0 same-strand Phosphoglucomutase/phosphomannomutase, C-terminal domain
5 PF12005.10 0.73 130 706.0 same-strand Protein of unknown function (DUF3499)
6 PF01933.20 0.78 138 468.0 opposite-strand 2-phospho-L-lactate transferase CofD
7 PF00881.26 0.78 138 1472.0 opposite-strand Nitroreductase family
8 PF00483.25 0.63 112 4225.5 same-strand Nucleotidyl transferase
++ More..