Protein Information |
Information Type | Description |
---|---|
Protein name | Glutamyl-tRNA(Gln) amidotransferase subunit C (Glu-ADT subunit C) (EC 6.3.5.-) |
NCBI Accession ID | AE000783.1 |
Organism | Borrelia burgdorferi (strain ATCC 35210 / B31 / CIP 102532 / DSM 4680) |
Left | 351056 |
Right | 351331 |
Strand | - |
Nucleotide Sequence | TTGAAAGATATACATTTAAAAAATAGCTTAAAATTAAGCTTAGTGACACTTAGTAGAGAGAGTGAAGATAAATTTATTTCAAAATTTGAGAAAGTTATTAAATTGGTTAATAAAATTTCAAATTTTGAGGTTCAAATTAATTTTAATGCTAATAAGAAAAAGATTTCTACGTTGCGCGAGGATAAAGTAGAATTTTCTCTTTCTATTGAAGCAATTAAAAAACTTAGTAATTCGTTTTTAGATGGATATTTTTCATCTCCTAAAATATTGGAGTAA |
Sequence | MKDIHLKNSLKLSLVTLSRESEDKFISKFEKVIKLVNKISNFEVQINFNANKKKISTLREDKVEFSLSIEAIKKLSNSFLDGYFSSPKILE |
Source of smORF | Swiss-Prot |
Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln) (By similarity). {ECO:0000250}. |
Pubmed ID | 9403685 |
Domain | CDD:412411 |
Functional Category | Others |
Uniprot ID | O51318 |
ORF Length (Amino Acid) | 91 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 349515 | 349790 | - | NC_015921.1 | Borreliella bissettii DN127 |
2 | 351856 | 352131 | - | NZ_CP015796.1 | Borreliella mayonii |
3 | 350546 | 350821 | - | NZ_CP028861.1 | Borreliella garinii |
4 | 349647 | 349922 | - | NZ_CP044535.1 | Borrelia maritima |
5 | 346863 | 347111 | - | NZ_CP013704.1 | Borrelia anserina Es |
6 | 354450 | 354725 | - | NZ_CP011060.1 | Borrelia hermsii CC1 |
7 | 363972 | 364247 | - | NZ_CP028884.1 | Borrelia turcica IST7 |
8 | 553857 | 554132 | + | NZ_CP024333.1 | Borrelia miyamotoi |
9 | 352959 | 353243 | - | NZ_CP007022.1 | Borrelia parkeri HR1 |
10 | 353082 | 353366 | - | NC_008710.1 | Borrelia turicatae 91E135 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00380.21 | 1.0 | 10 | 4220.5 | same-strand | Ribosomal protein S9/S16 |
2 | PF00572.20 | 1.0 | 10 | 3760.5 | same-strand | Ribosomal protein L13 |
3 | PF02934.17 | 1.0 | 10 | 1446.0 | same-strand | GatB/GatE catalytic domain |
4 | PF02637.20 | 1.0 | 10 | 1446.0 | same-strand | GatB domain |
5 | PF01425.23 | 1.0 | 10 | 11.0 | same-strand | Amidase |
6 | PF13361.8 | 1.0 | 10 | 10.0 | same-strand | UvrD-like helicase C-terminal domain |
7 | PF13245.8 | 1.0 | 10 | 10.0 | same-strand | AAA domain |
8 | PF13538.8 | 1.0 | 10 | 10.0 | same-strand | UvrD-like helicase C-terminal domain |
9 | PF13413.8 | 1.0 | 10 | 2107.5 | same-strand | Helix-turn-helix domain |
10 | PF12844.9 | 1.0 | 10 | 2107.5 | same-strand | Helix-turn-helix domain |
11 | PF03548.17 | 0.6 | 6 | 3319.5 | same-strand | Outer membrane lipoprotein carrier protein LolA |
12 | PF05670.15 | 1.0 | 10 | 4146.5 | opposite-strand | NFACT protein RNA binding domain |
13 | PF00224.23 | 1.0 | 10 | 5664.5 | opposite-strand | Pyruvate kinase, barrel domain |
14 | PF02887.18 | 1.0 | 10 | 5664.5 | opposite-strand | Pyruvate kinase, alpha/beta domain |