ProsmORF-pred
Result : O51318
Protein Information
Information Type Description
Protein name Glutamyl-tRNA(Gln) amidotransferase subunit C (Glu-ADT subunit C) (EC 6.3.5.-)
NCBI Accession ID AE000783.1
Organism Borrelia burgdorferi (strain ATCC 35210 / B31 / CIP 102532 / DSM 4680)
Left 351056
Right 351331
Strand -
Nucleotide Sequence TTGAAAGATATACATTTAAAAAATAGCTTAAAATTAAGCTTAGTGACACTTAGTAGAGAGAGTGAAGATAAATTTATTTCAAAATTTGAGAAAGTTATTAAATTGGTTAATAAAATTTCAAATTTTGAGGTTCAAATTAATTTTAATGCTAATAAGAAAAAGATTTCTACGTTGCGCGAGGATAAAGTAGAATTTTCTCTTTCTATTGAAGCAATTAAAAAACTTAGTAATTCGTTTTTAGATGGATATTTTTCATCTCCTAAAATATTGGAGTAA
Sequence MKDIHLKNSLKLSLVTLSRESEDKFISKFEKVIKLVNKISNFEVQINFNANKKKISTLREDKVEFSLSIEAIKKLSNSFLDGYFSSPKILE
Source of smORF Swiss-Prot
Function Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln) (By similarity). {ECO:0000250}.
Pubmed ID 9403685
Domain CDD:412411
Functional Category Others
Uniprot ID O51318
ORF Length (Amino Acid) 91
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 10
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 349515 349790 - NC_015921.1 Borreliella bissettii DN127
2 351856 352131 - NZ_CP015796.1 Borreliella mayonii
3 350546 350821 - NZ_CP028861.1 Borreliella garinii
4 349647 349922 - NZ_CP044535.1 Borrelia maritima
5 346863 347111 - NZ_CP013704.1 Borrelia anserina Es
6 354450 354725 - NZ_CP011060.1 Borrelia hermsii CC1
7 363972 364247 - NZ_CP028884.1 Borrelia turcica IST7
8 553857 554132 + NZ_CP024333.1 Borrelia miyamotoi
9 352959 353243 - NZ_CP007022.1 Borrelia parkeri HR1
10 353082 353366 - NC_008710.1 Borrelia turicatae 91E135
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_015921.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF00380.21 1.0 10 4220.5 same-strand Ribosomal protein S9/S16
2 PF00572.20 1.0 10 3760.5 same-strand Ribosomal protein L13
3 PF02934.17 1.0 10 1446.0 same-strand GatB/GatE catalytic domain
4 PF02637.20 1.0 10 1446.0 same-strand GatB domain
5 PF01425.23 1.0 10 11.0 same-strand Amidase
6 PF13361.8 1.0 10 10.0 same-strand UvrD-like helicase C-terminal domain
7 PF13245.8 1.0 10 10.0 same-strand AAA domain
8 PF13538.8 1.0 10 10.0 same-strand UvrD-like helicase C-terminal domain
9 PF13413.8 1.0 10 2107.5 same-strand Helix-turn-helix domain
10 PF12844.9 1.0 10 2107.5 same-strand Helix-turn-helix domain
11 PF03548.17 0.6 6 3319.5 same-strand Outer membrane lipoprotein carrier protein LolA
12 PF05670.15 1.0 10 4146.5 opposite-strand NFACT protein RNA binding domain
13 PF00224.23 1.0 10 5664.5 opposite-strand Pyruvate kinase, barrel domain
14 PF02887.18 1.0 10 5664.5 opposite-strand Pyruvate kinase, alpha/beta domain
++ More..