Result : O50462
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Antitoxin RelB |
| NCBI Accession ID | AL123456.3 |
| Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Left | 1388975 |
| Right | 1389244 |
| Strand | - |
| Nucleotide Sequence | ATGGCTGTTGTCCCACTGGGCGAAGTCCGCAATCGCCTCTCTGAGTACGTCGCCGAAGTTGAGCTGACACACGAGCGCATCACGATAACCCGGCACGGTCATCCGGCGGCGGTATTGATCTCGGCCGATGACCTGGCGTCCATCGAGGAAACGCTGGAGGTGCTACGCACCCCTGGCGCCAGCGAGGCCATTCGTGAAGGCCTCGCCGATGTTGCCGCAGGGCGCTTCGTGAGCAACGACGAGATCCGCAACCGTTACACCGCGCGGTGA |
| Sequence | MAVVPLGEVRNRLSEYVAEVELTHERITITRHGHPAAVLISADDLASIEETLEVLRTPGASEAIREGLADVAAGRFVSNDEIRNRYTAR |
| Source of smORF | Swiss-Prot |
| Function | Antitoxin component of a type II toxin-antitoxin (TA) system. Upon expression in M.smegmatis neutralizes the effect of toxin RelE. {ECO:0000269|Pubmed:20498855}.; Induces its own promoter, in combination with RelE represses its own promoter. Binds DNA in complex with toxin RelE but not alone. {ECO:0000269|Pubmed:19114484}. |
| Pubmed ID | 9634230 19099550 19114484 20011113 20498855 21969609 |
| Domain | CDD:415595 |
| Functional Category | Antitoxin_type_2_and_DNA-binding |
| Uniprot ID | O50462 |
| ORF Length (Amino Acid) | 89 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1388975 | 1389244 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 1409062 | 1409331 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 3821957 | 3822226 | - | NZ_AP022606.1 | Mycobacterium branderi |
| 4 | 2722573 | 2722839 | + | NZ_CP061007.1 | Saccharopolyspora spinosa |
| 5 | 7274259 | 7274525 | - | NZ_CP031142.1 | Saccharopolyspora pogona |
| 6 | 1804280 | 1804549 | + | NZ_AP022605.1 | Mycobacterium doricum |
| 7 | 4247366 | 4247635 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 8 | 137226 | 137495 | - | NZ_CP020811.1 | Mycobacterium dioxanotrophicus |
| 9 | 251269 | 251544 | + | NC_014158.1 | Tsukamurella paurometabola DSM 20162 |
| 10 | 888741 | 889022 | - | NC_013739.1 | Conexibacter woesei DSM 14684 |
| 11 | 2365013 | 2365282 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 12 | 3872492 | 3872758 | - | NC_014830.1 | Intrasporangium calvum DSM 43043 |
| 13 | 2176883 | 2177149 | - | NZ_CP060789.1 | Tessaracoccus defluvii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05016.17 | 0.69 | 9 | -3 | same-strand | ParE toxin of type II toxin-antitoxin system, parDE |
++ More..