Result : A2C4Z1
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 50S ribosomal protein L29 |
| NCBI Accession ID | CP000553.1 |
| Organism | Prochlorococcus marinus (strain NATL1A) |
| Left | 1642990 |
| Right | 1643202 |
| Strand | - |
| Nucleotide Sequence | ATGAGCAAAAAAACTACGAAAGATGTACGGAATCTCTCTGATTCCGAGATGTCAGACAAGATTCAAAATCTTCGTAAAGAACTTTTTGACCTTCGTTTTAAGCAAGCCACTAGACAGCTAGCTAAAACTCACCGTTTCAAAGAGGCACGAACTGAATTGGCTCAACTTTTAACGGTTTCTAACGAGCGAAGCCGCTCAAACACATCATCTTGA |
| Sequence | MSKKTTKDVRNLSDSEMSDKIQNLRKELFDLRFKQATRQLAKTHRFKEARTELAQLLTVSNERSRSNTSS |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl09943. Profile Description: N/A. This family represents the N-terminal region (approximately 8 residues) of the eukaryotic mitochondrial 39-S ribosomal protein L47 (MRP-L47). Mitochondrial ribosomal proteins (MRPs) are the counterparts of the cytoplasmic ribosomal proteins, in that they fulfil similar functions in protein biosynthesis. However, they are distinct in number, features and primary structure. |
| Pubmed ID | 18159947 |
| Domain | CDD:415815 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | A2C4Z1 |
| ORF Length (Amino Acid) | 70 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1757565 | 1757777 | + | NC_019675.1 | Cyanobium gracile PCC 6307 |
| 2 | 2470913 | 2471125 | - | NZ_AP018202.1 | Thermostichus vulcanus NIES-2134 |
| 3 | 77699 | 77911 | + | NC_004113.1 | Thermosynechococcus vestitus BP-1 |
| 4 | 1560254 | 1560460 | - | NC_005042.1 | Prochlorococcus marinus subsp. marinus str. CCMP1375 |
| 5 | 61584 | 61781 | - | NZ_CP018092.1 | Synechococcus lividus PCC 6715 |
| 6 | 6461500 | 6461715 | - | NC_019751.1 | Calothrix sp. PCC 6303 |
| 7 | 4733684 | 4733854 | + | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 8 | 5189658 | 5189864 | + | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 9 | 1924258 | 1924491 | + | NZ_CP042326.1 | Euhalothece natronophila Z-M001 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_019675.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03947.20 | 1.0 | 9 | 1901 | same-strand | Ribosomal Proteins L2, C-terminal domain |
| 2 | PF00181.25 | 1.0 | 9 | 1901 | same-strand | Ribosomal Proteins L2, RNA binding domain |
| 3 | PF00203.23 | 1.0 | 9 | 1598 | same-strand | Ribosomal protein S19 |
| 4 | PF00237.21 | 1.0 | 9 | 1226 | same-strand | Ribosomal protein L22p/L17e |
| 5 | PF00189.22 | 1.0 | 9 | 478 | same-strand | Ribosomal protein S3, C-terminal domain |
| 6 | PF07650.19 | 1.0 | 9 | 478 | same-strand | KH domain |
| 7 | PF00252.20 | 1.0 | 9 | 4 | same-strand | Ribosomal protein L16p/L10e |
| 8 | PF00366.22 | 1.0 | 9 | 11 | same-strand | Ribosomal protein S17 |
| 9 | PF00238.21 | 1.0 | 9 | 279 | same-strand | Ribosomal protein L14p/L23e |
| 10 | PF17136.6 | 1.0 | 9 | 646 | same-strand | Ribosomal proteins 50S L24/mitochondrial 39S L24 |
| 11 | PF00467.31 | 1.0 | 9 | 646 | same-strand | KOW motif |
| 12 | PF00673.23 | 1.0 | 9 | 1058 | same-strand | ribosomal L5P family C-terminus |
| 13 | PF00281.21 | 1.0 | 9 | 1058 | same-strand | Ribosomal protein L5 |
| 14 | PF00410.21 | 1.0 | 9 | 1615 | same-strand | Ribosomal protein S8 |
++ More..