ProsmORF-pred
Result : A2BVK2
Protein Information
Information Type Description
Protein name Photosystem I reaction center subunit XII (PSI-M)
NCBI Accession ID CP000552.1
Organism Prochlorococcus marinus (strain MIT 9515)
Left 541388
Right 541492
Strand +
Nucleotide Sequence ATGGAACCATCTCAATCAATCAATTTAATTATCCTTGGTCTAATTGTAGTAATGCATGCAGGAGTATTAGCTTTAAGGCTTGGCATAAGTTTAGCTAGAATTTAA
Sequence MEPSQSINLIILGLIVVMHAGVLALRLGISLARI
Source of smORF Swiss-Prot
Function The ORF matches to the profile of cl26892. Profile Description: Photosystem I protein M (PsaM). Members of this protein family are PsaM, which is subunit XII of the photosystem I reaction center. This protein is found in both the Cyanobacteria and the chloroplasts of plants, but is absent from non-oxygenic photosynthetic bacteria such as Rhodobacter sphaeroides. Species that contain photosystem I also contain photosystem II, which splits water and releases molecular oxygen. The seed alignment for this model includes sequences from pfam07465 and additional sequences, as from Prochlorococcus. [Energy metabolism, Photosynthesis]
Pubmed ID 18159947
Domain CDD:421407
Functional Category Others
Uniprot ID A2BVK2
ORF Length (Amino Acid) 34
++ More..