Protein Information |
Information Type | Description |
---|---|
Protein name | Sec-independent protein translocase protein TatA |
NCBI Accession ID | CP000544.1 |
Organism | Halorhodospira halophila (strain DSM 244 / SL1) (Ectothiorhodospira halophila (strain DSM 244 / SL1)) |
Left | 1184289 |
Right | 1184582 |
Strand | - |
Nucleotide Sequence | ATGGGATTCAATATCTGGTCGTTGCTGATCATTCTGCTGATCGTGGCGCTGCTGTTTGGAACCAAGAAGCTGCGCAACATCGGCGGTGACCTGGGTGGCGCCATCCGCGGCTTCAAGGAGTCGATGCGCGAGGGTGAGGAGGAAGAGGCGCAGAAGCGCGCAGACGGTGAGTCCTCGGACGAGCCGGAGCCGCTGGAGCACCAGGACGAGCCCGCCCCCGAGCAGACGACCCAGGCCCGGGAGAGCAGTTCAGCCCGCCAGAGTGCCGAGCACCACGACCGCAGCACCTCGTAA |
Sequence | MGFNIWSLLIILLIVALLFGTKKLRNIGGDLGGAIRGFKESMREGEEEEAQKRADGESSDEPEPLEHQDEPAPEQTTQARESSSARQSAEHHDRSTS |
Source of smORF | Swiss-Prot |
Function | Part of the twin-arginine translocation (Tat) system that transports large folded proteins containing a characteristic twin-arginine motif in their signal peptide across membranes. TatA could form the protein-conducting channel of the Tat system. {ECO:0000255|HAMAP-Rule:MF_00236}. |
Pubmed ID | |
Domain | |
Functional Category | Others |
Uniprot ID | A1WW03 |
ORF Length (Amino Acid) | 97 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1184289 | 1184582 | - | NC_008789.1 | Halorhodospira halophila SL1 |
2 | 3226482 | 3226724 | - | NZ_CP009354.1 | Vibrio tubiashii ATCC 19109 |
3 | 78524 | 78766 | + | NZ_AP019651.1 | Vibrio taketomensis |
4 | 2809171 | 2809413 | - | NZ_AP019657.1 | Vibrio ponticus |
5 | 249513 | 249749 | + | NZ_CP044069.1 | Vibrio vulnificus |
6 | 2811595 | 2811831 | - | NZ_CP022741.1 | Vibrio qinghaiensis |
7 | 1148121 | 1148432 | - | NZ_AP018558.1 | Hydrogenophilus thermoluteolus |
8 | 3759758 | 3760003 | - | NZ_CP014864.1 | Microbulbifer thermotolerans |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00902.20 | 1.0 | 8 | 467.5 | same-strand | Sec-independent protein translocase protein (TatC) |
2 | PF00490.23 | 0.62 | 5 | 2436 | same-strand | Delta-aminolevulinic acid dehydratase |
3 | PF01026.23 | 0.62 | 5 | 1505 | opposite-strand | TatD related DNase |
4 | PF03109.18 | 0.75 | 6 | 52.0 | same-strand | ABC1 atypical kinase-like domain |
5 | PF02036.19 | 0.62 | 5 | 1683 | same-strand | SCP-2 sterol transfer family |
6 | PF01209.20 | 0.75 | 6 | 2298.5 | same-strand | ubiE/COQ5 methyltransferase family |
7 | PF13649.8 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
8 | PF08241.14 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
9 | PF13489.8 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
10 | PF08242.14 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
11 | PF02646.18 | 0.62 | 5 | 3138 | same-strand | RmuC family |
12 | PF00892.22 | 0.62 | 5 | 4854 | opposite-strand | EamA-like transporter family |
13 | PF13847.8 | 0.62 | 5 | 2298 | same-strand | Methyltransferase domain |