Result : A1WW03
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Sec-independent protein translocase protein TatA |
| NCBI Accession ID | CP000544.1 |
| Organism | Halorhodospira halophila (strain DSM 244 / SL1) (Ectothiorhodospira halophila (strain DSM 244 / SL1)) |
| Left | 1184289 |
| Right | 1184582 |
| Strand | - |
| Nucleotide Sequence | ATGGGATTCAATATCTGGTCGTTGCTGATCATTCTGCTGATCGTGGCGCTGCTGTTTGGAACCAAGAAGCTGCGCAACATCGGCGGTGACCTGGGTGGCGCCATCCGCGGCTTCAAGGAGTCGATGCGCGAGGGTGAGGAGGAAGAGGCGCAGAAGCGCGCAGACGGTGAGTCCTCGGACGAGCCGGAGCCGCTGGAGCACCAGGACGAGCCCGCCCCCGAGCAGACGACCCAGGCCCGGGAGAGCAGTTCAGCCCGCCAGAGTGCCGAGCACCACGACCGCAGCACCTCGTAA |
| Sequence | MGFNIWSLLIILLIVALLFGTKKLRNIGGDLGGAIRGFKESMREGEEEEAQKRADGESSDEPEPLEHQDEPAPEQTTQARESSSARQSAEHHDRSTS |
| Source of smORF | Swiss-Prot |
| Function | Part of the twin-arginine translocation (Tat) system that transports large folded proteins containing a characteristic twin-arginine motif in their signal peptide across membranes. TatA could form the protein-conducting channel of the Tat system. {ECO:0000255|HAMAP-Rule:MF_00236}. |
| Pubmed ID | |
| Domain | |
| Functional Category | Others |
| Uniprot ID | A1WW03 |
| ORF Length (Amino Acid) | 97 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1184289 | 1184582 | - | NC_008789.1 | Halorhodospira halophila SL1 |
| 2 | 3226482 | 3226724 | - | NZ_CP009354.1 | Vibrio tubiashii ATCC 19109 |
| 3 | 78524 | 78766 | + | NZ_AP019651.1 | Vibrio taketomensis |
| 4 | 2809171 | 2809413 | - | NZ_AP019657.1 | Vibrio ponticus |
| 5 | 249513 | 249749 | + | NZ_CP044069.1 | Vibrio vulnificus |
| 6 | 2811595 | 2811831 | - | NZ_CP022741.1 | Vibrio qinghaiensis |
| 7 | 1148121 | 1148432 | - | NZ_AP018558.1 | Hydrogenophilus thermoluteolus |
| 8 | 3759758 | 3760003 | - | NZ_CP014864.1 | Microbulbifer thermotolerans |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP019651.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00902.20 | 1.0 | 8 | 467.5 | same-strand | Sec-independent protein translocase protein (TatC) |
| 2 | PF00490.23 | 0.62 | 5 | 2436 | same-strand | Delta-aminolevulinic acid dehydratase |
| 3 | PF01026.23 | 0.62 | 5 | 1505 | opposite-strand | TatD related DNase |
| 4 | PF03109.18 | 0.75 | 6 | 52.0 | same-strand | ABC1 atypical kinase-like domain |
| 5 | PF02036.19 | 0.62 | 5 | 1683 | same-strand | SCP-2 sterol transfer family |
| 6 | PF01209.20 | 0.75 | 6 | 2298.5 | same-strand | ubiE/COQ5 methyltransferase family |
| 7 | PF13649.8 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
| 8 | PF08241.14 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
| 9 | PF13489.8 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
| 10 | PF08242.14 | 0.75 | 6 | 2298.5 | same-strand | Methyltransferase domain |
| 11 | PF02646.18 | 0.62 | 5 | 3138 | same-strand | RmuC family |
| 12 | PF00892.22 | 0.62 | 5 | 4854 | opposite-strand | EamA-like transporter family |
| 13 | PF13847.8 | 0.62 | 5 | 2298 | same-strand | Methyltransferase domain |
++ More..