Result : O31706
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Molybdopterin synthase sulfur carrier subunit (MPT synthase subunit 1) (Molybdenum cofactor biosynthesis protein D) (Molybdopterin-converting factor small subunit) (Molybdopterin-converting factor subunit 1) (Sulfur carrier protein MoaD) |
| NCBI Accession ID | AF012285.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 4535 |
| Right | 4768 |
| Strand | + |
| Nucleotide Sequence | ATGATTAAAATTCTTTTATTTGCAGGGCTTGCTGAACAGGCCGGTACACAAGCAATAGAAATAGATATGGAACAAGCAACCACAGATGAAATAAAAGCGAGTCTAAAAGAACAATACGGTCTTGAATCTATTGATACGGCTATGATTGCCGTTAACGAAAGCTATGTAAAAGAAAATACCTCTGTATCTTCGGGTGACACGGTAGCCATCATACCGCCGGTCAGCGGGGGATGA |
| Sequence | MIKILLFAGLAEQAGTQAIEIDMEQATTDEIKASLKEQYGLESIDTAMIAVNESYVKENTSVSSGDTVAIIPPVSGG |
| Source of smORF | Swiss-Prot |
| Function | Involved in sulfur transfer in the conversion of molybdopterin precursor Z to molybdopterin. {ECO:0000250}. |
| Pubmed ID | 9384377 |
| Domain | CDD:421700 |
| Functional Category | Others |
| Uniprot ID | O31706 |
| ORF Length (Amino Acid) | 77 |
++ More..
| Conservation Analysis |
No. of Species: 19
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1499432 | 1499665 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 1463236 | 1463469 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 3 | 1676342 | 1676575 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 4 | 1404743 | 1404976 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 5 | 1470944 | 1471177 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 6 | 1502956 | 1503189 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 7 | 485936 | 486169 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 8 | 1406266 | 1406499 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 9 | 2552126 | 2552359 | - | NZ_CP011937.1 | Bacillus velezensis |
| 10 | 1618009 | 1618242 | + | NZ_LT603683.1 | Bacillus glycinifermentans |
| 11 | 1604144 | 1604377 | + | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 12 | 1627545 | 1627778 | + | NZ_CP023665.1 | Bacillus paralicheniformis |
| 13 | 130689 | 130922 | - | NZ_CP043404.1 | Bacillus safensis |
| 14 | 294102 | 294335 | - | NZ_CP017786.1 | Bacillus xiamenensis |
| 15 | 1402839 | 1403072 | + | NZ_CP011150.1 | Bacillus altitudinis |
| 16 | 3239821 | 3240054 | - | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 17 | 1062452 | 1062682 | - | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 18 | 3506135 | 3506368 | - | NZ_CP022437.1 | Virgibacillus necropolis |
| 19 | 3131010 | 3131249 | - | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000964.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12804.9 | 0.89 | 17 | 3328 | same-strand | MobA-like NTP transferase domain |
| 2 | PF00899.23 | 0.89 | 17 | 2258 | same-strand | ThiF family |
| 3 | PF03453.19 | 0.95 | 18 | 949.0 | same-strand | MoeA N-terminal region (domain I and II) |
| 4 | PF00994.26 | 0.95 | 18 | 950.0 | same-strand | Probable molybdopterin binding domain |
| 5 | PF03454.17 | 0.95 | 18 | 949.0 | same-strand | MoeA C-terminal region (domain IV) |
| 6 | PF03205.16 | 1.0 | 19 | 467 | same-strand | Molybdopterin guanine dinucleotide synthesis protein B |
| 7 | PF02391.19 | 1.0 | 19 | -7 | same-strand | MoaE protein |
| 8 | PF00005.29 | 0.79 | 15 | 2005.5 | same-strand | ABC transporter |
| 9 | PF04893.19 | 0.79 | 15 | 3919 | same-strand | Yip1 domain |
| 10 | PF16576.7 | 0.79 | 15 | 4619 | same-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
| 11 | PF13437.8 | 0.79 | 15 | 4619 | same-strand | HlyD family secretion protein |
| 12 | PF02463.21 | 0.63 | 12 | 5752.0 | same-strand | RecF/RecN/SMC N terminal domain |
++ More..