Result : O31625
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Sporulation-specific transcription factor SpoVIF (Stage VI sporulation protein F) |
| NCBI Accession ID | AL009126.3 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 1253385 |
| Right | 1253639 |
| Strand | + |
| Nucleotide Sequence | ATGGATAATCAATTTTTTAAGAACATCGAAAAGAAAACAGGTGTGAAGATGCAGGATGTAATGAATCTTGCCGGATCACTCCAAAACGCTAATTTTAAAGATGAAAATACAGTGCGCAGTGTGATTAACCGCGTAGCGCAGATGGCAAACAGACGCGTGCCAAAAGAATTAGAAGATAAAATTGTGGAATCTATTACAAGCGGAAAAGAAAAGCTTGATTTTGGCACGATTTCTAAAATGATGGATAATAAATAA |
| Sequence | MDNQFFKNIEKKTGVKMQDVMNLAGSLQNANFKDENTVRSVINRVAQMANRRVPKELEDKIVESITSGKEKLDFGTISKMMDNK |
| Source of smORF | Swiss-Prot |
| Function | Transcription factor involved in spore coat assembly and spore resistance. Regulates the transcription of at least cgeA, cotG and cotS. {ECO:0000269|Pubmed:14523132, ECO:0000269|Pubmed:14702409}. |
| Pubmed ID | 9384377 14523132 14702409 |
| Domain | CDD:404879 |
| Functional Category | Others |
| Uniprot ID | O31625 |
| ORF Length (Amino Acid) | 84 |
++ More..
| Conservation Analysis |
No. of Species: 51
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1253385 | 1253639 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 1179826 | 1180080 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 3 | 1231752 | 1232006 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 4 | 1222515 | 1222769 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 5 | 1416871 | 1417125 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 6 | 1257178 | 1257432 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 7 | 736163 | 736417 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 8 | 1153146 | 1153400 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 9 | 2792015 | 2792269 | - | NZ_CP011937.1 | Bacillus velezensis |
| 10 | 1328958 | 1329215 | + | NZ_LT603683.1 | Bacillus glycinifermentans |
| 11 | 1282275 | 1282532 | + | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 12 | 1380394 | 1380651 | + | NZ_CP023665.1 | Bacillus paralicheniformis |
| 13 | 1153698 | 1153955 | + | NZ_CP011150.1 | Bacillus altitudinis |
| 14 | 344180 | 344437 | - | NZ_CP043404.1 | Bacillus safensis |
| 15 | 470849 | 471106 | - | NZ_CP017786.1 | Bacillus xiamenensis |
| 16 | 3287822 | 3288079 | + | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 17 | 3042677 | 3042934 | - | NZ_CP070511.1 | Parageobacillus toebii |
| 18 | 1768396 | 1768650 | + | NZ_CP042593.1 | Bacillus dafuensis |
| 19 | 1137686 | 1137940 | + | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 20 | 1207754 | 1208011 | + | NZ_CP014342.1 | Geobacillus subterraneus |
| 21 | 880786 | 881043 | + | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 22 | 33010 | 33267 | + | NZ_CP061470.1 | Geobacillus zalihae |
| 23 | 3094702 | 3094959 | - | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 24 | 1394777 | 1395034 | - | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 25 | 1518107 | 1518361 | + | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 26 | 1426101 | 1426355 | + | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 27 | 335067 | 335321 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 28 | 668950 | 669204 | + | NZ_CP012152.1 | Anoxybacillus gonensis |
| 29 | 2117903 | 2118115 | + | NZ_CP017703.1 | Aeribacillus pallidus |
| 30 | 389252 | 389506 | - | NZ_CP022983.1 | Cytobacillus kochii |
| 31 | 988310 | 988573 | + | NZ_CP012024.1 | Bacillus smithii |
| 32 | 64476 | 64730 | - | NZ_CP041305.1 | Cytobacillus ciccensis |
| 33 | 1560248 | 1560502 | + | NZ_CP053989.1 | Niallia circulans |
| 34 | 3896555 | 3896809 | + | NZ_CP030926.1 | Peribacillus butanolivorans |
| 35 | 3085688 | 3085942 | - | NZ_CP016020.1 | Bacillus weihaiensis |
| 36 | 2785336 | 2785593 | - | NZ_CP065425.1 | Heyndrickxia vini |
| 37 | 1278267 | 1278521 | - | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 38 | 1015260 | 1015520 | + | NZ_CP018866.1 | Sutcliffiella cohnii |
| 39 | 2940300 | 2940557 | - | NZ_LS483476.1 | Lederbergia lentus |
| 40 | 1813453 | 1813707 | - | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 41 | 1385525 | 1385782 | + | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 42 | 724735 | 724992 | + | NZ_CP024035.1 | Priestia aryabhattai |
| 43 | 3187142 | 3187399 | + | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 44 | 4947221 | 4947478 | - | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 45 | 2500681 | 2500935 | - | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
| 46 | 1443711 | 1443962 | + | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 47 | 1442440 | 1442691 | + | NZ_CP064875.1 | Bacillus toyonensis |
| 48 | 1460051 | 1460302 | + | NZ_CP032365.1 | Bacillus wiedmannii |
| 49 | 3642664 | 3642915 | - | NZ_CP040336.1 | Bacillus luti |
| 50 | 1492514 | 1492765 | + | NC_011725.1 | Bacillus cereus B4264 |
| 51 | 490861 | 491106 | + | NC_017668.1 | Halobacillus halophilus DSM 2266 |
| 52 | 2295393 | 2295653 | - | NZ_CP020772.1 | Halobacillus mangrovi |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000964.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF09680.12 | 0.76 | 39 | 133.5 | same-strand | Family of unknown function |
| 2 | PF13673.9 | 0.65 | 33 | 2794 | opposite-strand | Acetyltransferase (GNAT) domain |
| 3 | PF00583.27 | 0.63 | 32 | 2795.5 | opposite-strand | Acetyltransferase (GNAT) family |
| 4 | PF13508.9 | 0.65 | 33 | 2794 | opposite-strand | Acetyltransferase (GNAT) domain |
++ More..