Result : O31617

Protein Information

• Protein name: Sulfur carrier protein ThiS (Thiamine biosynthesis protein ThiS)
• NCBI Accession ID: AL009126.3
• Organism: Bacillus subtilis (strain 168)
• Left: 1244844
• Right: 1245044
• Strand: +
• Nucleotide Sequence: ATGCTACAGCTGAACGGTAAAGACGTGAAGTGGAAAAAAGACACAGGTACAATTCAAGACCTGCTGGCGTCGTATCAGCTTGAAAATAAAATCGTTATCGTGGAAAGAAATAAAGAAATAATCGGGAAAGAACGCTATCACGAGGTTGAGCTTTGTGATCGTGATGTCATTGAAATTGTCCATTTTGTAGGAGGCGGATGA
• Sequence: MLQLNGKDVKWKKDTGTIQDLLASYQLENKIVIVERNKEIIGKERYHEVELCDRDVIEIVHFVGGG
• Source of smORF: Swiss-Prot
• Function: Is the sulfur donor in the synthesis of the thiazole phosphate moiety of thiamine phosphate. {ECO:0000269|Pubmed:15489164}.
• Pubmed ID: 9384377 14567704 15489164 15362849
• Domain: CDD:421700
• Functional Category: Others
• Uniprot ID: O31617
• ORF Length (Amino Acid): 66

Conservation Analysis

No. of Species: 27

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1244844	1245044	+	NC_000964.3	Bacillus subtilis subsp. subtilis str. 168
2	1223204	1223404	+	NZ_CP013984.1	Bacillus inaquosorum
3	1171277	1171477	+	NZ_CP048852.1	Bacillus tequilensis
4	1213997	1214173	+	NZ_CP034943.1	Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499
5	1408340	1408540	+	NZ_CP033052.1	Bacillus vallismortis
6	1248585	1248785	+	NZ_CP051464.1	Bacillus mojavensis
7	744820	745020	-	NZ_CP029364.1	Bacillus halotolerans
8	1320604	1320804	+	NZ_LT603683.1	Bacillus glycinifermentans
9	2800534	2800737	-	NZ_CP011937.1	Bacillus velezensis
10	1144675	1144878	+	NZ_CP053376.1	Bacillus amyloliquefaciens
11	1372102	1372305	+	NZ_CP023665.1	Bacillus paralicheniformis
12	1273918	1274121	+	NC_006270.3	Bacillus licheniformis DSM 13 = ATCC 14580
13	479524	479715	-	NZ_CP017786.1	Bacillus xiamenensis
14	352837	353028	-	NZ_CP043404.1	Bacillus safensis
15	1145232	1145411	+	NZ_CP011150.1	Bacillus altitudinis
16	2914612	2914782	+	NZ_LR134338.1	Brevibacillus brevis
17	2920443	2920637	+	NZ_CP026363.1	Brevibacillus agri
18	2639176	2639352	+	NZ_CP018622.1	Virgibacillus dokdonensis
19	3239858	3240061	-	NZ_CP070511.1	Parageobacillus toebii
20	2861857	2862060	+	NZ_CP017703.1	Aeribacillus pallidus
21	2106646	2106816	+	NZ_CP017703.1	Aeribacillus pallidus
22	401425	401592	+	NC_011959.1	Thermomicrobium roseum DSM 5159
23	3366047	3366217	-	NZ_CP018058.1	Geobacillus thermocatenulatus
24	1622982	1623179	+	NZ_CP015108.1	Sporosarcina ureae
25	648810	648980	+	NC_006510.1	Geobacillus kaustophilus HTA426
26	1637867	1638037	-	NZ_CP061472.1	Geobacillus thermoleovorans
27	3315365	3315535	+	NZ_CP061470.1	Geobacillus zalihae
28	3451038	3451205	-	NZ_CP013652.1	Paenibacillus naphthalenovorans

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000964.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF03070.18	0.63	17	1688	same-strand	TENA/THI-4/PQQC family
2	PF02581.19	0.89	24	1093	same-strand	Thiamine monophosphate synthase
3	PF01266.26	0.81	22	0	same-strand	FAD dependent oxidoreductase
4	PF05690.16	1.0	27	3	same-strand	Thiazole biosynthesis protein ThiG
5	PF00899.23	0.85	23	766	same-strand	ThiF family
6	PF08543.14	0.63	17	1797	same-strand	Phosphomethylpyrimidine kinase