Result : O31484
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YczJ |
| NCBI Accession ID | AL009126.3 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 463496 |
| Right | 463783 |
| Strand | - |
| Nucleotide Sequence | ATGGTCAGAGAGGCAGCAATGCTTCACATTAAAGAAGGCCTTGAACAAGAGTTTGAGGATGCATTCCGGCAAGCTGCGCCGATTATTTCCGGCATGAAGGGCTATATCACTCACTCGTTATCAAAATGCATGGAGGAAACGCATAAATATCTGCTTCTTGTGGAGTGGGAAACACTTGAGGACCATACGGAAGGCTTTCGCGGTTCTTCAGAGTATCAAGAGTGGAAAGCCTTGCTTCATCGGTTCTATACCCCGTTCCCGACGGTCGAGCATTTTCAGGATGTGTAA |
| Sequence | MVREAAMLHIKEGLEQEFEDAFRQAAPIISGMKGYITHSLSKCMEETHKYLLLVEWETLEDHTEGFRGSSEYQEWKALLHRFYTPFPTVEHFQDV |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl10022. Profile Description: Antibiotic biosynthesis monooxygenase. The function of this family is unknown, but it is upregulated in response to salt stress in Populus balsamifera. It is also found at the C-terminus of an fructose 1,6-bisphosphate aldolase from Hydrogenophilus thermoluteolus. Arthrobacter nicotinovorans ORF106 is found in the pA01 plasmid, which encodes genes for molybdopterin uptake and degradation of plant alkaloid nicotine. The structure of one has been solved and the domain forms an a/b barrel dimer. Although there is a clear duplication within the domain it is not obviously detectable in the sequence. |
| Pubmed ID | 9384377 |
| Domain | CDD:415830 |
| Functional Category | Others |
| Uniprot ID | O31484 |
| ORF Length (Amino Acid) | 95 |
++ More..
| Conservation Analysis |
No. of Species: 127
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 463496 | 463783 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 415437 | 415724 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 3 | 460799 | 461086 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 4 | 439531 | 439821 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 5 | 1548150 | 1548440 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 6 | 617720 | 618007 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 7 | 461159 | 461449 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 8 | 3501970 | 3502290 | + | NZ_CP011937.1 | Bacillus velezensis |
| 9 | 451765 | 452085 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 10 | 4831144 | 4831437 | + | NZ_CP030926.1 | Peribacillus butanolivorans |
| 11 | 5513713 | 5514006 | - | NZ_CP030926.1 | Peribacillus butanolivorans |
| 12 | 2287084 | 2287377 | - | NZ_CP008724.1 | Staphylococcus xylosus |
| 13 | 4233906 | 4234199 | + | NZ_CP041305.1 | Cytobacillus ciccensis |
| 14 | 968597 | 968893 | + | NZ_LS483476.1 | Lederbergia lentus |
| 15 | 624900 | 625211 | + | NZ_CP009286.1 | Paenibacillus stellifer |
| 16 | 529513 | 529809 | + | NZ_CP004078.1 | Paenibacillus sabinae T27 |
| 17 | 3507372 | 3507668 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 18 | 2211255 | 2211548 | + | NZ_CP022437.1 | Virgibacillus necropolis |
| 19 | 511593 | 511904 | + | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 20 | 2895864 | 2896145 | + | NZ_CP018155.1 | Tenacibaculum todarodis |
| 21 | 3124058 | 3124351 | - | NZ_CP045293.1 | Paenibacillus guangzhouensis |
| 22 | 2488590 | 2488883 | - | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
| 23 | 108613 | 108906 | + | NZ_CP038015.1 | Paenisporosarcina antarctica |
| 24 | 2534905 | 2535195 | - | NZ_CP014782.1 | Shewanella psychrophila |
| 25 | 548825 | 549118 | - | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
| 26 | 4191718 | 4192020 | + | NZ_CP060723.1 | Pedobacter roseus |
| 27 | 3286081 | 3286368 | - | NC_019771.1 | Anabaena cylindrica PCC 7122 |
| 28 | 1531712 | 1532023 | - | NZ_CP009355.1 | Vibrio tubiashii ATCC 19109 |
| 29 | 5258950 | 5259243 | + | NZ_CP016809.1 | Paenibacillus ihbetae |
| 30 | 1386564 | 1386857 | + | NZ_CP031941.1 | Nostoc sphaeroides |
| 31 | 657886 | 658182 | + | NZ_CP009285.1 | Paenibacillus borealis |
| 32 | 2134385 | 2134672 | + | NZ_CP013023.1 | Paenibacillus bovis |
| 33 | 2609750 | 2610031 | + | NZ_CP039456.1 | Changchengzhania lutea |
| 34 | 592296 | 592592 | + | NZ_CP009288.1 | Paenibacillus durus |
| 35 | 1215162 | 1215455 | + | NZ_CP033433.1 | Cohnella candidum |
| 36 | 4549256 | 4549549 | + | NZ_CP041217.1 | Saccharibacillus brassicae |
| 37 | 643761 | 644057 | + | NZ_CP009428.1 | Paenibacillus odorifer |
| 38 | 6362635 | 6362940 | + | NZ_CP045295.1 | Paenibacillus cellulositrophicus |
| 39 | 2580329 | 2580625 | + | NZ_CP068595.1 | Paenibacillus sonchi |
| 40 | 5979301 | 5979594 | + | NZ_CP041146.1 | Nocardioides humi |
| 41 | 1729579 | 1729860 | - | NZ_CP017478.1 | Urechidicola croceus |
| 42 | 135020 | 135316 | + | NZ_CP011389.1 | Deinococcus soli (ex Cha et al. 2016) |
| 43 | 762782 | 763078 | + | NZ_LN831776.1 | Paenibacillus riograndensis SBR5 |
| 44 | 4408285 | 4408587 | + | NZ_CP014476.1 | Methylomonas denitrificans |
| 45 | 1393657 | 1393953 | - | NZ_CP029797.1 | Paraliobacillus zengyii |
| 46 | 977452 | 977742 | + | NZ_CP040991.1 | Vibrio furnissii |
| 47 | 691920 | 692216 | + | NZ_CP009287.1 | Paenibacillus graminis |
| 48 | 2606613 | 2606909 | + | NZ_CP048429.1 | Paenibacillus jilunlii |
| 49 | 6617346 | 6617642 | - | NZ_CP055153.1 | Adhaeribacter radiodurans |
| 50 | 1330719 | 1331009 | + | NC_014012.1 | Shewanella violacea DSS12 |
| 51 | 540769 | 541065 | + | NC_019751.1 | Calothrix sp. PCC 6303 |
| 52 | 35222 | 35512 | + | NZ_CP014034.2 | Vibrio fluvialis |
| 53 | 2517024 | 2517323 | + | NZ_CP018863.1 | Arthrobacter crystallopoietes |
| 54 | 1408753 | 1409094 | + | NZ_CP051883.1 | Aeromonas salmonicida |
| 55 | 3381001 | 3381294 | + | NZ_CP047491.1 | Microbulbifer hydrolyticus |
| 56 | 628002 | 628310 | + | NZ_CP017688.1 | Flavobacterium crassostreae |
| 57 | 2283105 | 2283419 | + | NZ_CP017688.1 | Flavobacterium crassostreae |
| 58 | 2146785 | 2147078 | + | NZ_CP018199.1 | Staphylococcus succinus |
| 59 | 1740512 | 1740799 | - | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 60 | 2253107 | 2253400 | - | NZ_AP022188.1 | Aeromonas media |
| 61 | 2160359 | 2160703 | - | NZ_CP041695.1 | Nocardia otitidiscaviarum |
| 62 | 2365917 | 2366207 | - | NZ_CP042436.1 | Mucilaginibacter ginsenosidivorans |
| 63 | 3314284 | 3314625 | - | NZ_AP021881.1 | Sulfuriferula nivalis |
| 64 | 1247665 | 1247958 | - | NZ_CP010028.1 | Deinococcus radiopugnans |
| 65 | 117870 | 118181 | - | NC_015138.1 | Acidovorax avenae subsp. avenae ATCC 19860 |
| 66 | 1126983 | 1127285 | + | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
| 67 | 2963718 | 2964008 | + | NZ_CP014143.1 | Microbulbifer aggregans |
| 68 | 3791245 | 3791547 | - | NZ_CP034248.1 | Paenibacillus lentus |
| 69 | 3632042 | 3632338 | + | NZ_CP027793.1 | Rhodococcus hoagii |
| 70 | 3165761 | 3166072 | - | NZ_LR134352.1 | Nocardia asteroides |
| 71 | 1704986 | 1705282 | + | NZ_CP053069.1 | Usitatibacter rugosus |
| 72 | 2424134 | 2424445 | + | NZ_LR134376.1 | Aeromonas encheleia |
| 73 | 4334163 | 4334459 | + | NC_009664.2 | Kineococcus radiotolerans SRS30216 = ATCC BAA-149 |
| 74 | 2241339 | 2241671 | - | NZ_CP050851.1 | Aeromonas hydrophila |
| 75 | 790676 | 790972 | + | NZ_AP019308.1 | Paenibacillus baekrokdamisoli |
| 76 | 6561674 | 6561973 | - | NC_019729.1 | Oscillatoria nigro-viridis PCC 7112 |
| 77 | 1463537 | 1463833 | + | NZ_CP013910.1 | Deinococcus actinosclerus |
| 78 | 1687122 | 1687427 | - | NC_017094.1 | Leptospirillum ferrooxidans C2-3 |
| 79 | 4778404 | 4778694 | - | NZ_LR590484.1 | Sphingobacterium thalpophilum |
| 80 | 744655 | 744960 | + | NC_017770.1 | Solitalea canadensis DSM 3403 |
| 81 | 5065774 | 5066079 | + | NZ_CP016907.1 | Flavobacterium anhuiense |
| 82 | 3239522 | 3239812 | - | NZ_CP041637.1 | Formosa sediminum |
| 83 | 2256106 | 2256402 | - | NZ_CP055156.1 | Adhaeribacter swui |
| 84 | 1033222 | 1033533 | - | NZ_CP011387.1 | Deinococcus puniceus |
| 85 | 2386743 | 2387033 | + | NC_016001.1 | Flavobacterium branchiophilum FL-15 |
| 86 | 2892788 | 2893099 | + | NZ_CP016076.1 | Actinoalloteichus fjordicus |
| 87 | 2054385 | 2054687 | + | NC_012526.1 | Deinococcus deserti VCD115 |
| 88 | 428171 | 428482 | - | NZ_AP014640.1 | Leptolyngbya boryana IAM M-101 |
| 89 | 1657958 | 1658251 | - | NZ_CP029494.1 | Deinococcus irradiatisoli |
| 90 | 307769 | 308065 | + | NZ_CP053073.1 | Usitatibacter palustris |
| 91 | 5077540 | 5077842 | + | NZ_CP043612.1 | Flavobacterium nitrogenifigens |
| 92 | 2210100 | 2210402 | + | NZ_CP037933.1 | Flavobacterium nackdongense |
| 93 | 3668055 | 3668354 | - | NZ_CP034346.1 | Paenibacillus lutimineralis |
| 94 | 581719 | 582030 | - | NZ_CP020918.1 | Flavobacterium faecale |
| 95 | 592400 | 592690 | - | NZ_CP011102.1 | Listeria weihenstephanensis |
| 96 | 4171222 | 4171524 | + | NC_009441.1 | Flavobacterium johnsoniae UW101 |
| 97 | 2895624 | 2895917 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 98 | 5166170 | 5166475 | - | NZ_CP023698.1 | Streptomyces viridifaciens |
| 99 | 1296470 | 1296778 | + | NZ_CP013745.1 | Arthrobacter alpinus |
| 100 | 142301 | 142591 | - | NZ_CP030033.1 | Cryobacterium soli |
| 101 | 2079166 | 2079450 | + | NC_017790.1 | Deinococcus gobiensis I-0 |
| 102 | 2136245 | 2136535 | + | NZ_CP016282.1 | Cryobacterium arcticum |
| 103 | 2665583 | 2665900 | - | NZ_CP062803.1 | Cupriavidus basilensis |
| 104 | 3238568 | 3238870 | - | NZ_CP029255.1 | Flavobacterium crocinum |
| 105 | 4130028 | 4130306 | + | NZ_CP058277.1 | Mycobacterium marinum |
| 106 | 1718715 | 1719035 | + | NZ_CP021081.1 | Deinococcus ficus |
| 107 | 2542149 | 2542427 | + | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
| 108 | 8289422 | 8289709 | - | NZ_CP034550.1 | Saccharothrix syringae |
| 109 | 1581908 | 1582198 | + | NZ_CP013235.1 | Collimonas arenae |
| 110 | 1043608 | 1043937 | + | NZ_CP012401.1 | Azospirillum thiophilum |
| 111 | 3510024 | 3510320 | + | NZ_CP039291.1 | Cellulomonas shaoxiangyii |
| 112 | 861676 | 861960 | - | NZ_CP031500.1 | Deinococcus radiodurans |
| 113 | 2684271 | 2684576 | + | NC_015588.1 | Isoptericola variabilis 225 |
| 114 | 4457877 | 4458176 | - | NZ_CP060790.1 | Acidovorax monticola |
| 115 | 3091627 | 3091926 | + | NZ_CP011257.1 | Ralstonia mannitolilytica |
| 116 | 2094703 | 2095002 | - | NZ_CP016022.1 | Ralstonia insidiosa |
| 117 | 3939279 | 3939584 | + | NC_009925.1 | Acaryochloris marina MBIC11017 |
| 118 | 1463794 | 1464087 | + | NC_018020.1 | Turneriella parva DSM 21527 |
| 119 | 3694884 | 3695180 | - | NZ_AP023172.1 | Rhodococcus qingshengii |
| 120 | 3304087 | 3304386 | + | NZ_CP012943.1 | Ralstonia solanacearum |
| 121 | 3169623 | 3169940 | - | NZ_CP029397.2 | Acinetobacter defluvii |
| 122 | 5036570 | 5036866 | + | NZ_CP040896.1 | Hymenobacter jejuensis |
| 123 | 710606 | 710902 | - | NZ_CP039731.1 | Aquitalea aquatilis |
| 124 | 2102360 | 2102659 | + | NZ_CP068285.1 | Ralstonia syzygii subsp. celebesensis |
| 125 | 1565177 | 1565473 | + | NZ_CP013979.1 | Agromyces aureus |
| 126 | 141523 | 141813 | + | NC_013530.1 | Xylanimonas cellulosilytica DSM 15894 |
| 127 | 3192322 | 3192636 | - | NZ_CP015961.1 | Dietzia timorensis |
| 128 | 739293 | 739592 | + | NZ_CP028913.1 | Agromyces badenianii |
| 129 | 2716205 | 2716495 | - | NZ_AP022609.1 | Mycolicibacter hiberniae |
++ More..