Result : O31454
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YbfN |
| NCBI Accession ID | AB006424.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 52585 |
| Right | 52863 |
| Strand | + |
| Nucleotide Sequence | ATGGAGAAACAAATCATCAGCTGGATTACAGATTATCAGAACACCGGAGATGAAGCCGTCCTGCGGCAAGTGCGAGAAGTGTGCTGGCCGATCGTTGAAGCGGTTTTGCAAGAGAAAGTAATGGATGATGAACAAGCGAACAATTTGCGCGAAAAAGGAATCGAGCGGTTTCCATTCATCATCAGCAAATACCAAGCGGATGTGCAGCTTCCGGTTGAGACATTTTTACAAAATACGTATCGGTTTTACTTTCATCAGGTGATGAGAGAATCCAGCTAA |
| Sequence | MEKQIISWITDYQNTGDEAVLRQVREVCWPIVEAVLQEKVMDDEQANNLREKGIERFPFIISKYQADVQLPVETFLQNTYRFYFHQVMRESS |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9384377 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | O31454 |
| ORF Length (Amino Acid) | 92 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 249595 | 249873 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 209830 | 210108 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 3 | 249348 | 249626 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 4 | 241326 | 241604 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 5 | 1768614 | 1768889 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 6 | 241646 | 241921 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 7 | 385072 | 385353 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 8 | 274344 | 274604 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000964.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10794.11 | 0.75 | 6 | 3110.5 | same-strand | Protein of unknown function (DUF2606) |
| 2 | PF12697.9 | 0.88 | 7 | 2050 | same-strand | Alpha/beta hydrolase family |
| 3 | PF01066.23 | 1.0 | 8 | 1321.0 | same-strand | CDP-alcohol phosphatidyltransferase |
| 4 | PF09335.13 | 1.0 | 8 | 842.0 | same-strand | SNARE associated Golgi protein |
| 5 | PF06695.13 | 0.62 | 5 | 842 | same-strand | Putative small multi-drug export protein |
| 6 | PF02666.17 | 1.0 | 8 | 56.5 | same-strand | Phosphatidylserine decarboxylase |
| 7 | PF05139.16 | 0.75 | 6 | 105.5 | same-strand | Erythromycin esterase |
| 8 | PF12833.9 | 0.62 | 5 | 1555 | same-strand | Helix-turn-helix domain |
| 9 | PF00165.25 | 0.62 | 5 | 1555 | same-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 10 | PF17773.3 | 1.0 | 8 | 2640.0 | same-strand | UPF0176 acylphosphatase like domain |
| 11 | PF12368.10 | 1.0 | 8 | 2640.0 | same-strand | Rhodanase C-terminal |
| 12 | PF00581.22 | 1.0 | 8 | 2640.0 | same-strand | Rhodanese-like domain |
| 13 | PF00375.20 | 0.88 | 7 | 3645 | opposite-strand | Sodium:dicarboxylate symporter family |
| 14 | PF02378.20 | 0.88 | 7 | 5037 | opposite-strand | Phosphotransferase system, EIIC |
| 15 | PF00358.22 | 0.88 | 7 | 5034 | opposite-strand | phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1 |
| 16 | PF00367.22 | 0.88 | 7 | 5034 | opposite-strand | phosphotransferase system, EIIB |
++ More..